Mutagenetix > Incidental Mutations

Incidental Mutation 'R4287:Fpgt'

322055

Institutional Source

Beutler Lab

Gene Symbol

Fpgt

Ensembl Gene

ENSMUSG00000053870

Gene Name

fucose-1-phosphate guanylyltransferase

Synonyms

1700016E03Rik

MMRRC Submission

041652-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.130) question?

Stock #

R4287 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

155084918-155093403 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 155091360 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000142127 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029833] [ENSMUST00000066568] [ENSMUST00000192383] [ENSMUST00000194376]

AlphaFold

G5E8F4

Predicted Effect

probably benign
Transcript: ENSMUST00000029833

SMART Domains

Protein: ENSMUSP00000029833
Gene: ENSMUSG00000028182

Domain	Start	End	E-Value	Type
SCOP:d1dcea3	36	155	3e-14	SMART
Blast:LRR	71	94	3e-6	BLAST
Blast:LRR	96	118	1e-5	BLAST
IQ	214	236	3.68e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000066568

SMART Domains

Protein: ENSMUSP00000068939
Gene: ENSMUSG00000053870

Domain	Start	End	E-Value	Type
low complexity region	82	92	N/A	INTRINSIC
Pfam:Fucokinase	106	524	1.8e-147	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082831

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192247

Predicted Effect

probably benign
Transcript: ENSMUST00000192383

SMART Domains

Protein: ENSMUSP00000141372
Gene: ENSMUSG00000028182

Domain	Start	End	E-Value	Type
Pfam:LRR_8	50	109	9e-9	PFAM
Pfam:LRR_4	72	117	1.9e-8	PFAM
Pfam:LRR_1	73	94	5.1e-3	PFAM
IQ	214	236	3.68e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192959

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193071

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194095

Predicted Effect

probably benign
Transcript: ENSMUST00000194376

SMART Domains

Protein: ENSMUSP00000142127
Gene: ENSMUSG00000028182

Domain	Start	End	E-Value	Type
Pfam:LRR_8	50	109	7.2e-9	PFAM
Pfam:LRR_4	72	117	1.5e-8	PFAM
Pfam:LRR_1	73	94	4.2e-3	PFAM
IQ	214	236	3.68e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194899

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195418

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195505

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-fucose is a key sugar in glycoproteins and other complex carbohydrates since it may be involved in many of the functional roles of these macromolecules, such as in cell-cell recognition. The fucosyl donor for these fucosylated oligosaccharides is GDP-beta-L-fucose. There are two alternate pathways for the biosynthesis of GDP-fucose; the major pathway converts GDP-alpha-D-mannose to GDP-beta-L-fucose. The protein encoded by this gene participates in an alternate pathway that is present in certain mammalian tissues, such as liver and kidney, and appears to function as a salvage pathway to reutilize L-fucose arising from the turnover of glycoproteins and glycolipids. This pathway involves the phosphorylation of L-fucose to form beta-L-fucose-1-phosphate, and then condensation of the beta-L-fucose-1-phosphate with GTP by fucose-1-phosphate guanylyltransferase to form GDP-beta-L-fucose. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream TNNI3 interacting kinase (TNNI3K) gene. [provided by RefSeq, Dec 2010]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anapc5	A	G	5: 122,800,601	V362A	probably benign	Het
Ash1l	T	A	3: 89,066,415	C2594S	probably damaging	Het
Ccdc82	C	A	9: 13,253,418	Q303K	probably benign	Het
Cog1	A	G	11: 113,654,027	Y345C	probably damaging	Het
Glrb	A	T	3: 80,845,232	V408D	possibly damaging	Het
Gm7135	A	G	1: 97,400,398		noncoding transcript	Het
Il1rn	T	C	2: 24,349,545	L151P	probably damaging	Het
Itgav	G	T	2: 83,724,840	E36*	probably null	Het
Kidins220	G	A	12: 25,056,846	E1433K	possibly damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra3	A	G	6: 130,334,302	C39R	probably benign	Het
Lce1i	A	G	3: 92,777,435	S145P	unknown	Het
Memo1	T	C	17: 74,255,298		probably null	Het
Mpp3	G	A	11: 102,023,463	A102V	probably damaging	Het
Mug2	T	A	6: 122,063,673	D727E	probably benign	Het
Ndufb8	T	C	19: 44,552,691	I107V	probably benign	Het
Olfr186	A	T	16: 59,027,613	M98K	probably benign	Het
Pnn	C	T	12: 59,072,170	T513I	possibly damaging	Het
Ric8a	A	G	7: 140,861,422	Y210C	probably damaging	Het
Ripor2	G	A	13: 24,725,009	V1037M	probably damaging	Het
Rreb1	A	T	13: 37,931,931	T1089S	probably benign	Het
Rrs1	C	T	1: 9,546,215	S231L	probably damaging	Het
Rrs1	C	T	1: 9,546,223	R234C	possibly damaging	Het
Sec23ip	A	G	7: 128,777,333	D838G	probably benign	Het
Setbp1	T	C	18: 78,859,061	I464V	probably benign	Het
Slc25a51	C	T	4: 45,399,768	V141M	probably benign	Het
Slc41a3	A	T	6: 90,640,922	H310L	probably benign	Het
Smurf1	A	G	5: 144,891,458	S363P	probably benign	Het
Tln1	C	T	4: 43,543,509	R1269Q	probably benign	Het
Tmed3	A	G	9: 89,704,898	S10P	probably benign	Het
Tomm70a	T	G	16: 57,140,622	Y313D	probably damaging	Het
Umodl1	A	G	17: 30,988,065	E810G	probably benign	Het
Unc5c	T	C	3: 141,714,674	I52T	probably damaging	Het
Unc5d	T	A	8: 28,719,796	Y432F	probably benign	Het
Vmn2r97	A	T	17: 18,948,075		probably benign	Het
Zfp629	T	C	7: 127,611,938	Y233C	probably damaging	Het
Zfp986	T	C	4: 145,892,518		probably null	Het

Other mutations in Fpgt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01021:Fpgt	APN	3	155091492	missense	possibly damaging	0.92
IGL01412:Fpgt	APN	3	155086722	missense	probably benign	0.06
IGL01860:Fpgt	APN	3	155086846	missense	probably benign	0.38
IGL01977:Fpgt	APN	3	155088018	missense	probably damaging	0.99
IGL02136:Fpgt	APN	3	155093352	missense	probably benign
IGL02331:Fpgt	APN	3	155087862	missense	possibly damaging	0.90
IGL03106:Fpgt	APN	3	155087122	missense	probably damaging	1.00
PIT4431001:Fpgt	UTSW	3	155086785	missense	possibly damaging	0.95
R2072:Fpgt	UTSW	3	155087874	missense	probably damaging	1.00
R4607:Fpgt	UTSW	3	155086696	nonsense	probably null
R4608:Fpgt	UTSW	3	155086696	nonsense	probably null
R4873:Fpgt	UTSW	3	155087913	missense	probably damaging	1.00
R4875:Fpgt	UTSW	3	155087913	missense	probably damaging	1.00
R5973:Fpgt	UTSW	3	155087403	missense	probably damaging	1.00
R7134:Fpgt	UTSW	3	155091483	missense	probably damaging	1.00
R7300:Fpgt	UTSW	3	155086975	missense	probably damaging	0.98
R7505:Fpgt	UTSW	3	155086776	missense	possibly damaging	0.92
R7521:Fpgt	UTSW	3	155087128	missense	possibly damaging	0.96
R7690:Fpgt	UTSW	3	155087830	missense	probably damaging	1.00
R7736:Fpgt	UTSW	3	155087110	missense	probably benign	0.34
R7815:Fpgt	UTSW	3	155086652	missense	probably benign	0.00
R8061:Fpgt	UTSW	3	155087266	missense	probably benign	0.00
R9017:Fpgt	UTSW	3	155087266	missense	probably benign	0.01
R9298:Fpgt	UTSW	3	155087058	nonsense	probably null
R9375:Fpgt	UTSW	3	155087297	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- ATTCCAGTGTAAATTGTACTGAGGC -3'
(R):5'- GGATGTGGTTGCAATAACAGC -3'

Sequencing Primer
(F):5'- AAATAAGGTCTGGACTAGTTTCTCTG -3'
(R):5'- TGTGGTTGCAATAACAGCAGCTG -3'

Posted On

2015-06-20