Mutagenetix > Incidental Mutations

Incidental Mutation 'R4287:Smurf1'

322060

Institutional Source

Beutler Lab

Gene Symbol

Smurf1

Ensembl Gene

ENSMUSG00000038780

Gene Name

SMAD specific E3 ubiquitin protein ligase 1

Synonyms

4930431E10Rik

MMRRC Submission

041652-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4287 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

144876495-144965847 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 144891458 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 363 (S363P)

Ref Sequence

ENSEMBL: ENSMUSP00000106305 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085684] [ENSMUST00000100461] [ENSMUST00000110677]

AlphaFold

Q9CUN6

Predicted Effect

probably benign
Transcript: ENSMUST00000085684
AA Change: S337P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000082827
Gene: ENSMUSG00000038780
AA Change: S337P

Domain	Start	End	E-Value	Type
C2	14	117	3.03e-15	SMART
low complexity region	185	193	N/A	INTRINSIC
WW	235	267	1.06e-7	SMART
WW	281	313	8.66e-13	SMART
HECTc	392	731	3.48e-160	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000100461
AA Change: S337P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000098029
Gene: ENSMUSG00000038780
AA Change: S337P

Domain	Start	End	E-Value	Type
C2	14	117	3.03e-15	SMART
low complexity region	185	193	N/A	INTRINSIC
WW	235	267	1.06e-7	SMART
WW	281	313	8.66e-13	SMART
HECTc	392	728	2.72e-162	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110677
AA Change: S363P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000106305
Gene: ENSMUSG00000038780
AA Change: S363P

Domain	Start	End	E-Value	Type
C2	14	117	3.03e-15	SMART
low complexity region	185	193	N/A	INTRINSIC
WW	235	267	1.06e-7	SMART
WW	307	339	8.66e-13	SMART
HECTc	418	757	3.48e-160	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126822

Predicted Effect

unknown
Transcript: ENSMUST00000198621
AA Change: S132P

Meta Mutation Damage Score

0.0710

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin ligase that is specific for receptor-regulated SMAD proteins in the bone morphogenetic protein (BMP) pathway. This protein plays a key roll in the regulation of cell motility, cell signalling, and cell polarity. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for one knock-out allele display increased osteoblast function, bone density, and thickness of the cortical bone in long bones. Mice homozygous for a different knock-out allele are viable and only display gastrulation defects in combination with a Smurf2 knock-out allele. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anapc5	A	G	5: 122,800,601	V362A	probably benign	Het
Ash1l	T	A	3: 89,066,415	C2594S	probably damaging	Het
Ccdc82	C	A	9: 13,253,418	Q303K	probably benign	Het
Cog1	A	G	11: 113,654,027	Y345C	probably damaging	Het
Fpgt	T	C	3: 155,091,360		probably benign	Het
Glrb	A	T	3: 80,845,232	V408D	possibly damaging	Het
Gm7135	A	G	1: 97,400,398		noncoding transcript	Het
Il1rn	T	C	2: 24,349,545	L151P	probably damaging	Het
Itgav	G	T	2: 83,724,840	E36*	probably null	Het
Kidins220	G	A	12: 25,056,846	E1433K	possibly damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra3	A	G	6: 130,334,302	C39R	probably benign	Het
Lce1i	A	G	3: 92,777,435	S145P	unknown	Het
Memo1	T	C	17: 74,255,298		probably null	Het
Mpp3	G	A	11: 102,023,463	A102V	probably damaging	Het
Mug2	T	A	6: 122,063,673	D727E	probably benign	Het
Ndufb8	T	C	19: 44,552,691	I107V	probably benign	Het
Olfr186	A	T	16: 59,027,613	M98K	probably benign	Het
Pnn	C	T	12: 59,072,170	T513I	possibly damaging	Het
Ric8a	A	G	7: 140,861,422	Y210C	probably damaging	Het
Ripor2	G	A	13: 24,725,009	V1037M	probably damaging	Het
Rreb1	A	T	13: 37,931,931	T1089S	probably benign	Het
Rrs1	C	T	1: 9,546,215	S231L	probably damaging	Het
Rrs1	C	T	1: 9,546,223	R234C	possibly damaging	Het
Sec23ip	A	G	7: 128,777,333	D838G	probably benign	Het
Setbp1	T	C	18: 78,859,061	I464V	probably benign	Het
Slc25a51	C	T	4: 45,399,768	V141M	probably benign	Het
Slc41a3	A	T	6: 90,640,922	H310L	probably benign	Het
Tln1	C	T	4: 43,543,509	R1269Q	probably benign	Het
Tmed3	A	G	9: 89,704,898	S10P	probably benign	Het
Tomm70a	T	G	16: 57,140,622	Y313D	probably damaging	Het
Umodl1	A	G	17: 30,988,065	E810G	probably benign	Het
Unc5c	T	C	3: 141,714,674	I52T	probably damaging	Het
Unc5d	T	A	8: 28,719,796	Y432F	probably benign	Het
Vmn2r97	A	T	17: 18,948,075		probably benign	Het
Zfp629	T	C	7: 127,611,938	Y233C	probably damaging	Het
Zfp986	T	C	4: 145,892,518		probably null	Het

Other mutations in Smurf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00776:Smurf1	APN	5	144881774	missense	probably benign	0.00
IGL01577:Smurf1	APN	5	144893188	missense	probably damaging	0.99
IGL02232:Smurf1	APN	5	144886438	missense	probably damaging	1.00
IGL02407:Smurf1	APN	5	144884724	missense	probably damaging	1.00
IGL02959:Smurf1	APN	5	144899389	missense	probably damaging	1.00
IGL02997:Smurf1	APN	5	144898005	nonsense	probably null
IGL03227:Smurf1	APN	5	144899182	missense	probably damaging	1.00
IGL03293:Smurf1	APN	5	144881799	missense	probably benign
R1563:Smurf1	UTSW	5	144882513	missense	probably damaging	1.00
R1652:Smurf1	UTSW	5	144880664	missense	probably damaging	1.00
R2698:Smurf1	UTSW	5	144883562	unclassified	probably benign
R3794:Smurf1	UTSW	5	144901175	critical splice donor site	probably null
R4274:Smurf1	UTSW	5	144896775	intron	probably benign
R4282:Smurf1	UTSW	5	144882593	missense	probably damaging	1.00
R4643:Smurf1	UTSW	5	144879369	missense	probably damaging	1.00
R4723:Smurf1	UTSW	5	144893184	missense	probably damaging	1.00
R5496:Smurf1	UTSW	5	144882593	nonsense	probably null
R5702:Smurf1	UTSW	5	144901211	missense	possibly damaging	0.96
R5846:Smurf1	UTSW	5	144879380	missense	probably damaging	1.00
R6107:Smurf1	UTSW	5	144894504	missense	possibly damaging	0.75
R6263:Smurf1	UTSW	5	144881731	missense	probably damaging	0.96
R6477:Smurf1	UTSW	5	144889792	missense	possibly damaging	0.49
R6548:Smurf1	UTSW	5	144899497	missense	probably damaging	1.00
R6584:Smurf1	UTSW	5	144882523	missense	probably damaging	0.97
R6981:Smurf1	UTSW	5	144886369	missense	possibly damaging	0.69
R7062:Smurf1	UTSW	5	144893546	splice site	probably null
R7900:Smurf1	UTSW	5	144899373	missense	probably damaging	1.00
R8271:Smurf1	UTSW	5	144894087	missense	possibly damaging	0.53
R8361:Smurf1	UTSW	5	144883696	missense	probably damaging	1.00
R8919:Smurf1	UTSW	5	144883612	nonsense	probably null
R9312:Smurf1	UTSW	5	144894083	missense	probably damaging	1.00
R9324:Smurf1	UTSW	5	144880653	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AAGCAGAGTCCACCAAGATG -3'
(R):5'- TTGTCACTCATCTGAGCAGCC -3'

Sequencing Primer
(F):5'- TAACACAAACTTCCTTGCGTG -3'
(R):5'- ATCTGAGCAGCCCTGTCGTTAG -3'

Posted On

2015-06-20