Incidental Mutation 'R4287:Mug2'
ID 322062
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Name murinoglobulin 2
Synonyms
MMRRC Submission 041652-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R4287 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 122006761-122085965 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 122063673 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 727 (D727E)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
AlphaFold P28666
Predicted Effect probably benign
Transcript: ENSMUST00000081777
AA Change: D727E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: D727E

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc5 A G 5: 122,800,601 (GRCm38) V362A probably benign Het
Ash1l T A 3: 89,066,415 (GRCm38) C2594S probably damaging Het
Ccdc82 C A 9: 13,253,418 (GRCm38) Q303K probably benign Het
Cog1 A G 11: 113,654,027 (GRCm38) Y345C probably damaging Het
Fpgt T C 3: 155,091,360 (GRCm38) probably benign Het
Glrb A T 3: 80,845,232 (GRCm38) V408D possibly damaging Het
Gm7135 A G 1: 97,400,398 (GRCm38) noncoding transcript Het
Il1rn T C 2: 24,349,545 (GRCm38) L151P probably damaging Het
Itgav G T 2: 83,724,840 (GRCm38) E36* probably null Het
Kidins220 G A 12: 25,056,846 (GRCm38) E1433K possibly damaging Het
Klk14 G A 7: 43,692,077 (GRCm38) C51Y probably damaging Het
Klra3 A G 6: 130,334,302 (GRCm38) C39R probably benign Het
Lce1i A G 3: 92,777,435 (GRCm38) S145P unknown Het
Memo1 T C 17: 74,255,298 (GRCm38) probably null Het
Mpp3 G A 11: 102,023,463 (GRCm38) A102V probably damaging Het
Ndufb8 T C 19: 44,552,691 (GRCm38) I107V probably benign Het
Or5h18 A T 16: 59,027,613 (GRCm38) M98K probably benign Het
Pnn C T 12: 59,072,170 (GRCm38) T513I possibly damaging Het
Ric8a A G 7: 140,861,422 (GRCm38) Y210C probably damaging Het
Ripor2 G A 13: 24,725,009 (GRCm38) V1037M probably damaging Het
Rreb1 A T 13: 37,931,931 (GRCm38) T1089S probably benign Het
Rrs1 C T 1: 9,546,215 (GRCm38) S231L probably damaging Het
Rrs1 C T 1: 9,546,223 (GRCm38) R234C possibly damaging Het
Sec23ip A G 7: 128,777,333 (GRCm38) D838G probably benign Het
Setbp1 T C 18: 78,859,061 (GRCm38) I464V probably benign Het
Slc25a51 C T 4: 45,399,768 (GRCm38) V141M probably benign Het
Slc41a3 A T 6: 90,640,922 (GRCm38) H310L probably benign Het
Smurf1 A G 5: 144,891,458 (GRCm38) S363P probably benign Het
Tln1 C T 4: 43,543,509 (GRCm38) R1269Q probably benign Het
Tmed3 A G 9: 89,704,898 (GRCm38) S10P probably benign Het
Tomm70a T G 16: 57,140,622 (GRCm38) Y313D probably damaging Het
Umodl1 A G 17: 30,988,065 (GRCm38) E810G probably benign Het
Unc5c T C 3: 141,714,674 (GRCm38) I52T probably damaging Het
Unc5d T A 8: 28,719,796 (GRCm38) Y432F probably benign Het
Vmn2r97 A T 17: 18,948,075 (GRCm38) probably benign Het
Zfp629 T C 7: 127,611,938 (GRCm38) Y233C probably damaging Het
Zfp986 T C 4: 145,892,518 (GRCm38) probably null Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122,047,487 (GRCm38) missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122,040,654 (GRCm38) missense probably damaging 0.99
IGL01314:Mug2 APN 6 122,081,279 (GRCm38) missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122,049,628 (GRCm38) splice site probably benign
IGL01477:Mug2 APN 6 122,081,684 (GRCm38) splice site probably benign
IGL01926:Mug2 APN 6 122,036,104 (GRCm38) splice site probably benign
IGL02019:Mug2 APN 6 122,047,435 (GRCm38) missense probably benign 0.02
IGL02305:Mug2 APN 6 122,036,056 (GRCm38) missense probably benign
IGL02310:Mug2 APN 6 122,059,123 (GRCm38) splice site probably benign
IGL02484:Mug2 APN 6 122,072,753 (GRCm38) missense probably damaging 1.00
IGL02516:Mug2 APN 6 122,070,843 (GRCm38) missense probably damaging 1.00
IGL02531:Mug2 APN 6 122,072,771 (GRCm38) missense probably damaging 1.00
IGL02666:Mug2 APN 6 122,081,326 (GRCm38) missense probably damaging 1.00
IGL02936:Mug2 APN 6 122,081,387 (GRCm38) critical splice donor site probably null
R0114:Mug2 UTSW 6 122,040,648 (GRCm38) missense probably damaging 1.00
R0119:Mug2 UTSW 6 122,036,063 (GRCm38) missense probably benign 0.00
R0123:Mug2 UTSW 6 122,074,714 (GRCm38) missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122,071,011 (GRCm38) splice site probably benign
R0225:Mug2 UTSW 6 122,074,714 (GRCm38) missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122,081,599 (GRCm38) missense probably damaging 1.00
R0763:Mug2 UTSW 6 122,075,294 (GRCm38) missense probably benign
R0959:Mug2 UTSW 6 122,085,495 (GRCm38) missense probably benign 0.33
R1104:Mug2 UTSW 6 122,059,055 (GRCm38) missense probably benign
R1239:Mug2 UTSW 6 122,081,678 (GRCm38) splice site probably benign
R1318:Mug2 UTSW 6 122,077,402 (GRCm38) missense probably damaging 1.00
R1460:Mug2 UTSW 6 122,040,533 (GRCm38) splice site probably benign
R1706:Mug2 UTSW 6 122,036,232 (GRCm38) splice site probably benign
R1761:Mug2 UTSW 6 122,074,705 (GRCm38) missense probably benign 0.20
R1901:Mug2 UTSW 6 122,071,842 (GRCm38) missense probably benign 0.02
R1913:Mug2 UTSW 6 122,070,870 (GRCm38) missense probably damaging 1.00
R1943:Mug2 UTSW 6 122,079,639 (GRCm38) missense probably benign
R2054:Mug2 UTSW 6 122,077,492 (GRCm38) missense probably damaging 1.00
R2060:Mug2 UTSW 6 122,079,612 (GRCm38) missense probably benign
R2420:Mug2 UTSW 6 122,083,460 (GRCm38) missense probably damaging 1.00
R2432:Mug2 UTSW 6 122,084,376 (GRCm38) missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122,074,724 (GRCm38) splice site probably null
R2918:Mug2 UTSW 6 122,074,724 (GRCm38) splice site probably null
R3423:Mug2 UTSW 6 122,047,506 (GRCm38) splice site probably benign
R3834:Mug2 UTSW 6 122,049,787 (GRCm38) critical splice donor site probably null
R3902:Mug2 UTSW 6 122,075,567 (GRCm38) missense probably damaging 1.00
R3941:Mug2 UTSW 6 122,063,563 (GRCm38) missense probably benign
R4227:Mug2 UTSW 6 122,040,732 (GRCm38) missense probably benign 0.10
R4284:Mug2 UTSW 6 122,063,673 (GRCm38) missense probably benign 0.00
R4377:Mug2 UTSW 6 122,071,007 (GRCm38) critical splice donor site probably null
R4419:Mug2 UTSW 6 122,079,630 (GRCm38) missense probably damaging 1.00
R4498:Mug2 UTSW 6 122,082,752 (GRCm38) missense probably damaging 0.99
R4566:Mug2 UTSW 6 122,079,638 (GRCm38) missense probably benign 0.00
R4690:Mug2 UTSW 6 122,036,296 (GRCm38) missense probably benign
R4732:Mug2 UTSW 6 122,071,872 (GRCm38) missense probably damaging 0.99
R4733:Mug2 UTSW 6 122,071,872 (GRCm38) missense probably damaging 0.99
R4741:Mug2 UTSW 6 122,079,613 (GRCm38) missense probably benign
R4888:Mug2 UTSW 6 122,081,195 (GRCm38) missense probably damaging 1.00
R5199:Mug2 UTSW 6 122,040,660 (GRCm38) missense probably benign
R5347:Mug2 UTSW 6 122,081,592 (GRCm38) missense probably damaging 1.00
R5457:Mug2 UTSW 6 122,049,729 (GRCm38) nonsense probably null
R5495:Mug2 UTSW 6 122,079,650 (GRCm38) missense probably damaging 0.96
R5509:Mug2 UTSW 6 122,084,381 (GRCm38) missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122,083,500 (GRCm38) missense probably null 0.98
R6180:Mug2 UTSW 6 122,079,606 (GRCm38) missense probably benign 0.01
R6184:Mug2 UTSW 6 122,037,046 (GRCm38) missense probably benign
R6199:Mug2 UTSW 6 122,047,439 (GRCm38) missense probably benign 0.05
R6262:Mug2 UTSW 6 122,075,255 (GRCm38) missense probably damaging 1.00
R6416:Mug2 UTSW 6 122,082,754 (GRCm38) missense probably damaging 1.00
R6548:Mug2 UTSW 6 122,047,442 (GRCm38) missense probably damaging 1.00
R6703:Mug2 UTSW 6 122,078,694 (GRCm38) missense probably benign 0.25
R7106:Mug2 UTSW 6 122,082,721 (GRCm38) missense probably damaging 1.00
R7131:Mug2 UTSW 6 122,075,247 (GRCm38) missense probably damaging 1.00
R7372:Mug2 UTSW 6 122,083,466 (GRCm38) missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122,047,487 (GRCm38) missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122,040,570 (GRCm38) missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122,079,726 (GRCm38) missense probably benign 0.00
R7581:Mug2 UTSW 6 122,063,711 (GRCm38) missense probably damaging 1.00
R7582:Mug2 UTSW 6 122,079,644 (GRCm38) missense probably damaging 0.99
R7672:Mug2 UTSW 6 122,040,719 (GRCm38) missense probably benign 0.37
R7713:Mug2 UTSW 6 122,078,795 (GRCm38) missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122,081,358 (GRCm38) missense probably damaging 1.00
R7834:Mug2 UTSW 6 122,036,282 (GRCm38) missense probably benign
R7850:Mug2 UTSW 6 122,075,211 (GRCm38) missense probably damaging 1.00
R8029:Mug2 UTSW 6 122,081,545 (GRCm38) critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122,075,608 (GRCm38) missense probably benign 0.01
R8335:Mug2 UTSW 6 122,040,584 (GRCm38) missense probably benign
R8348:Mug2 UTSW 6 122,072,233 (GRCm38) nonsense probably null
R8557:Mug2 UTSW 6 122,063,701 (GRCm38) missense probably damaging 0.99
R8798:Mug2 UTSW 6 122,081,610 (GRCm38) missense probably damaging 1.00
R8823:Mug2 UTSW 6 122,063,689 (GRCm38) missense possibly damaging 0.89
R9029:Mug2 UTSW 6 122,084,369 (GRCm38) missense probably damaging 1.00
R9153:Mug2 UTSW 6 122,040,668 (GRCm38) missense possibly damaging 0.71
R9185:Mug2 UTSW 6 122,077,483 (GRCm38) missense probably benign 0.06
R9186:Mug2 UTSW 6 122,075,289 (GRCm38) missense probably damaging 0.99
R9418:Mug2 UTSW 6 122,040,741 (GRCm38) missense probably benign 0.00
R9464:Mug2 UTSW 6 122,051,731 (GRCm38) missense probably benign 0.01
R9622:Mug2 UTSW 6 122,051,792 (GRCm38) missense probably benign 0.29
Z1177:Mug2 UTSW 6 122,037,121 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTACACCACTATGTTCCATTG -3'
(R):5'- TTAACTATCAGGCAGGTACGTG -3'

Sequencing Primer
(F):5'- ACACCACTATGTTCCATTGAATTC -3'
(R):5'- CAGGCAGGTACGTGATAGTTTTTATG -3'
Posted On 2015-06-20