Incidental Mutation 'R4287:Zfp629'
ID 322064
Institutional Source Beutler Lab
Gene Symbol Zfp629
Ensembl Gene ENSMUSG00000045639
Gene Name zinc finger protein 629
Synonyms
MMRRC Submission 041652-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock # R4287 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 127607031-127615797 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 127611938 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 233 (Y233C)
Ref Sequence ENSEMBL: ENSMUSP00000116375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058038] [ENSMUST00000084564] [ENSMUST00000122066] [ENSMUST00000128731] [ENSMUST00000131318] [ENSMUST00000132524] [ENSMUST00000134446] [ENSMUST00000151107] [ENSMUST00000152315]
AlphaFold Q6A085
Predicted Effect probably damaging
Transcript: ENSMUST00000058038
AA Change: Y233C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053760
Gene: ENSMUSG00000045639
AA Change: Y233C

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 199 2.09e-3 SMART
ZnF_C2H2 205 227 6.08e-5 SMART
ZnF_C2H2 233 255 2.99e-4 SMART
ZnF_C2H2 261 283 1.45e-2 SMART
ZnF_C2H2 289 311 1.13e-4 SMART
ZnF_C2H2 317 339 9.88e-5 SMART
ZnF_C2H2 345 367 9.73e-4 SMART
ZnF_C2H2 373 395 9.22e-5 SMART
ZnF_C2H2 401 423 6.08e-5 SMART
ZnF_C2H2 429 451 7.78e-3 SMART
ZnF_C2H2 457 479 3.95e-4 SMART
ZnF_C2H2 485 507 1.15e-5 SMART
ZnF_C2H2 513 535 2.91e-2 SMART
ZnF_C2H2 568 590 9.58e-3 SMART
ZnF_C2H2 661 683 3.16e-3 SMART
ZnF_C2H2 713 735 9.73e-4 SMART
low complexity region 737 754 N/A INTRINSIC
ZnF_C2H2 766 788 2.57e-3 SMART
ZnF_C2H2 840 862 1.14e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000084564
AA Change: Y233C

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081612
Gene: ENSMUSG00000045639
AA Change: Y233C

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 199 2.09e-3 SMART
ZnF_C2H2 205 227 6.08e-5 SMART
ZnF_C2H2 233 255 2.99e-4 SMART
ZnF_C2H2 261 283 1.45e-2 SMART
ZnF_C2H2 289 311 1.13e-4 SMART
ZnF_C2H2 317 339 9.88e-5 SMART
ZnF_C2H2 345 367 9.73e-4 SMART
ZnF_C2H2 373 395 9.22e-5 SMART
ZnF_C2H2 401 423 6.08e-5 SMART
ZnF_C2H2 429 451 7.78e-3 SMART
ZnF_C2H2 457 479 3.95e-4 SMART
ZnF_C2H2 485 507 1.15e-5 SMART
ZnF_C2H2 513 535 2.91e-2 SMART
ZnF_C2H2 568 590 9.58e-3 SMART
ZnF_C2H2 661 683 3.16e-3 SMART
ZnF_C2H2 713 735 9.73e-4 SMART
low complexity region 737 754 N/A INTRINSIC
ZnF_C2H2 766 788 2.57e-3 SMART
ZnF_C2H2 840 862 1.14e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122066
AA Change: Y233C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113903
Gene: ENSMUSG00000045639
AA Change: Y233C

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 199 2.09e-3 SMART
ZnF_C2H2 205 227 6.08e-5 SMART
ZnF_C2H2 233 255 2.99e-4 SMART
ZnF_C2H2 261 283 1.45e-2 SMART
ZnF_C2H2 289 311 1.13e-4 SMART
ZnF_C2H2 317 339 9.88e-5 SMART
ZnF_C2H2 345 367 9.73e-4 SMART
ZnF_C2H2 373 395 9.22e-5 SMART
ZnF_C2H2 401 423 6.08e-5 SMART
ZnF_C2H2 429 451 7.78e-3 SMART
ZnF_C2H2 457 479 3.95e-4 SMART
ZnF_C2H2 485 507 1.15e-5 SMART
ZnF_C2H2 513 535 2.91e-2 SMART
ZnF_C2H2 568 590 9.58e-3 SMART
ZnF_C2H2 661 683 3.16e-3 SMART
ZnF_C2H2 713 735 9.73e-4 SMART
low complexity region 737 754 N/A INTRINSIC
ZnF_C2H2 766 788 2.57e-3 SMART
ZnF_C2H2 840 862 1.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128731
SMART Domains Protein: ENSMUSP00000140505
Gene: ENSMUSG00000045639

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131318
AA Change: Y233C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116375
Gene: ENSMUSG00000045639
AA Change: Y233C

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 199 2.09e-3 SMART
ZnF_C2H2 205 227 6.08e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132524
Predicted Effect probably benign
Transcript: ENSMUST00000134446
Predicted Effect probably benign
Transcript: ENSMUST00000151107
Predicted Effect probably benign
Transcript: ENSMUST00000152315
SMART Domains Protein: ENSMUSP00000114772
Gene: ENSMUSG00000045639

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 195 1.24e2 SMART
Meta Mutation Damage Score 0.4074 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc5 A G 5: 122,800,601 V362A probably benign Het
Ash1l T A 3: 89,066,415 C2594S probably damaging Het
Ccdc82 C A 9: 13,253,418 Q303K probably benign Het
Cog1 A G 11: 113,654,027 Y345C probably damaging Het
Fpgt T C 3: 155,091,360 probably benign Het
Glrb A T 3: 80,845,232 V408D possibly damaging Het
Gm7135 A G 1: 97,400,398 noncoding transcript Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Itgav G T 2: 83,724,840 E36* probably null Het
Kidins220 G A 12: 25,056,846 E1433K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra3 A G 6: 130,334,302 C39R probably benign Het
Lce1i A G 3: 92,777,435 S145P unknown Het
Memo1 T C 17: 74,255,298 probably null Het
Mpp3 G A 11: 102,023,463 A102V probably damaging Het
Mug2 T A 6: 122,063,673 D727E probably benign Het
Ndufb8 T C 19: 44,552,691 I107V probably benign Het
Olfr186 A T 16: 59,027,613 M98K probably benign Het
Pnn C T 12: 59,072,170 T513I possibly damaging Het
Ric8a A G 7: 140,861,422 Y210C probably damaging Het
Ripor2 G A 13: 24,725,009 V1037M probably damaging Het
Rreb1 A T 13: 37,931,931 T1089S probably benign Het
Rrs1 C T 1: 9,546,215 S231L probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sec23ip A G 7: 128,777,333 D838G probably benign Het
Setbp1 T C 18: 78,859,061 I464V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc41a3 A T 6: 90,640,922 H310L probably benign Het
Smurf1 A G 5: 144,891,458 S363P probably benign Het
Tln1 C T 4: 43,543,509 R1269Q probably benign Het
Tmed3 A G 9: 89,704,898 S10P probably benign Het
Tomm70a T G 16: 57,140,622 Y313D probably damaging Het
Umodl1 A G 17: 30,988,065 E810G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Unc5d T A 8: 28,719,796 Y432F probably benign Het
Vmn2r97 A T 17: 18,948,075 probably benign Het
Zfp986 T C 4: 145,892,518 probably null Het
Other mutations in Zfp629
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Zfp629 APN 7 127612724 missense probably damaging 0.97
IGL01541:Zfp629 APN 7 127612745 utr 5 prime probably benign
IGL02116:Zfp629 APN 7 127612718 missense probably damaging 1.00
IGL02134:Zfp629 APN 7 127611870 missense probably benign 0.22
IGL02547:Zfp629 APN 7 127611674 splice site probably null
IGL02858:Zfp629 APN 7 127610312 missense probably damaging 1.00
IGL02867:Zfp629 APN 7 127610031 unclassified probably benign
IGL02889:Zfp629 APN 7 127610031 unclassified probably benign
R6768_Zfp629_044 UTSW 7 127610825 missense probably benign 0.03
R0020:Zfp629 UTSW 7 127611169 missense probably benign 0.02
R0137:Zfp629 UTSW 7 127611686 missense probably damaging 1.00
R0219:Zfp629 UTSW 7 127612083 missense probably damaging 1.00
R1061:Zfp629 UTSW 7 127611989 missense probably damaging 1.00
R1182:Zfp629 UTSW 7 127610102 missense probably damaging 1.00
R1187:Zfp629 UTSW 7 127610229 missense probably benign
R1187:Zfp629 UTSW 7 127611887 missense probably damaging 1.00
R1217:Zfp629 UTSW 7 127612744 start gained probably benign
R1507:Zfp629 UTSW 7 127611861 nonsense probably null
R1526:Zfp629 UTSW 7 127610759 missense possibly damaging 0.69
R1622:Zfp629 UTSW 7 127611840 missense probably damaging 1.00
R1704:Zfp629 UTSW 7 127610864 missense probably benign 0.06
R1918:Zfp629 UTSW 7 127612000 missense probably damaging 1.00
R2147:Zfp629 UTSW 7 127610444 missense probably damaging 1.00
R2156:Zfp629 UTSW 7 127612379 missense probably benign 0.00
R2258:Zfp629 UTSW 7 127611791 missense probably damaging 1.00
R2994:Zfp629 UTSW 7 127611056 missense probably damaging 0.99
R3735:Zfp629 UTSW 7 127612778 splice site probably benign
R4610:Zfp629 UTSW 7 127612320 missense probably benign 0.26
R4758:Zfp629 UTSW 7 127610586 missense probably damaging 1.00
R4899:Zfp629 UTSW 7 127611018 missense possibly damaging 0.69
R4922:Zfp629 UTSW 7 127612127 missense probably damaging 1.00
R5414:Zfp629 UTSW 7 127611282 missense probably damaging 0.97
R5772:Zfp629 UTSW 7 127611135 missense probably damaging 1.00
R5907:Zfp629 UTSW 7 127610370 missense probably damaging 1.00
R6768:Zfp629 UTSW 7 127610825 missense probably benign 0.03
R7122:Zfp629 UTSW 7 127611312 missense probably damaging 0.99
R7156:Zfp629 UTSW 7 127612291 nonsense probably null
R7407:Zfp629 UTSW 7 127610243 missense probably benign
R7446:Zfp629 UTSW 7 127611029 missense probably benign 0.00
R7780:Zfp629 UTSW 7 127612429 missense probably benign 0.12
R7871:Zfp629 UTSW 7 127611995 missense probably damaging 1.00
R8542:Zfp629 UTSW 7 127611192 nonsense probably null
R9095:Zfp629 UTSW 7 127610375 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTGTAGGGCTTCTCACCTG -3'
(R):5'- TTAGCCAGTGGTCCAAACTGC -3'

Sequencing Primer
(F):5'- AGGGCTTCTCACCTGTGTGC -3'
(R):5'- TGGTCCAAACTGCTGCGG -3'
Posted On 2015-06-20