Incidental Mutation 'R4287:Ric8a'
ID322066
Institutional Source Beutler Lab
Gene Symbol Ric8a
Ensembl Gene ENSMUSG00000025485
Gene NameRIC8 guanine nucleotide exchange factor A
Synonymssynembryn, RIC-8, Ric8
MMRRC Submission 041652-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4287 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140856957-140864372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140861422 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 210 (Y210C)
Ref Sequence ENSEMBL: ENSMUSP00000147952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026557] [ENSMUST00000026558] [ENSMUST00000026559] [ENSMUST00000106048] [ENSMUST00000137024] [ENSMUST00000209766] [ENSMUST00000210296] [ENSMUST00000210708] [ENSMUST00000210710] [ENSMUST00000211179] [ENSMUST00000211624]
Predicted Effect probably benign
Transcript: ENSMUST00000026557
SMART Domains Protein: ENSMUSP00000026557
Gene: ENSMUSG00000025484

DomainStartEndE-ValueType
Pfam:SNARE 20 82 3.4e-13 PFAM
transmembrane domain 87 106 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000026558
AA Change: Y445C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026558
Gene: ENSMUSG00000025485
AA Change: Y445C

DomainStartEndE-ValueType
Pfam:Ric8 66 505 2.3e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026559
SMART Domains Protein: ENSMUSP00000026559
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
Pfam:SIR2 3 184 5.3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106048
SMART Domains Protein: ENSMUSP00000101663
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
Pfam:SIR2 3 184 8.7e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131850
Predicted Effect probably benign
Transcript: ENSMUST00000137024
SMART Domains Protein: ENSMUSP00000114247
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
Pfam:SIR2 3 178 1.7e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209318
Predicted Effect probably damaging
Transcript: ENSMUST00000209766
AA Change: Y210C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210601
Predicted Effect probably benign
Transcript: ENSMUST00000210708
Predicted Effect probably benign
Transcript: ENSMUST00000210710
Predicted Effect probably benign
Transcript: ENSMUST00000211179
Predicted Effect probably benign
Transcript: ENSMUST00000211624
Meta Mutation Damage Score 0.8309 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in lethality during gastrulation. Heterozygotes exhibit impaired spatial learning and increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc5 A G 5: 122,800,601 V362A probably benign Het
Ash1l T A 3: 89,066,415 C2594S probably damaging Het
Ccdc82 C A 9: 13,253,418 Q303K probably benign Het
Cog1 A G 11: 113,654,027 Y345C probably damaging Het
Fpgt T C 3: 155,091,360 probably benign Het
Glrb A T 3: 80,845,232 V408D possibly damaging Het
Gm7135 A G 1: 97,400,398 noncoding transcript Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Itgav G T 2: 83,724,840 E36* probably null Het
Kidins220 G A 12: 25,056,846 E1433K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra3 A G 6: 130,334,302 C39R probably benign Het
Lce1i A G 3: 92,777,435 S145P unknown Het
Memo1 T C 17: 74,255,298 probably null Het
Mpp3 G A 11: 102,023,463 A102V probably damaging Het
Mug2 T A 6: 122,063,673 D727E probably benign Het
Ndufb8 T C 19: 44,552,691 I107V probably benign Het
Olfr186 A T 16: 59,027,613 M98K probably benign Het
Pnn C T 12: 59,072,170 T513I possibly damaging Het
Ripor2 G A 13: 24,725,009 V1037M probably damaging Het
Rreb1 A T 13: 37,931,931 T1089S probably benign Het
Rrs1 C T 1: 9,546,215 S231L probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sec23ip A G 7: 128,777,333 D838G probably benign Het
Setbp1 T C 18: 78,859,061 I464V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc41a3 A T 6: 90,640,922 H310L probably benign Het
Smurf1 A G 5: 144,891,458 S363P probably benign Het
Tln1 C T 4: 43,543,509 R1269Q probably benign Het
Tmed3 A G 9: 89,704,898 S10P probably benign Het
Tomm70a T G 16: 57,140,622 Y313D probably damaging Het
Umodl1 A G 17: 30,988,065 E810G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Unc5d T A 8: 28,719,796 Y432F probably benign Het
Vmn2r97 A T 17: 18,948,075 probably benign Het
Zfp629 T C 7: 127,611,938 Y233C probably damaging Het
Zfp986 T C 4: 145,892,518 probably null Het
Other mutations in Ric8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Ric8a APN 7 140862357 missense probably benign 0.00
R0277:Ric8a UTSW 7 140857900 unclassified probably benign
R0529:Ric8a UTSW 7 140860893 missense probably damaging 1.00
R0707:Ric8a UTSW 7 140857973 unclassified probably benign
R1272:Ric8a UTSW 7 140862376 missense probably benign 0.22
R1627:Ric8a UTSW 7 140858178 missense probably damaging 0.98
R1655:Ric8a UTSW 7 140860895 missense probably benign 0.01
R2281:Ric8a UTSW 7 140861938 missense probably benign 0.44
R2327:Ric8a UTSW 7 140859558 missense probably damaging 1.00
R3721:Ric8a UTSW 7 140861961 critical splice donor site probably null
R4504:Ric8a UTSW 7 140858516 missense probably benign 0.03
R4505:Ric8a UTSW 7 140858516 missense probably benign 0.03
R4506:Ric8a UTSW 7 140858516 missense probably benign 0.03
R4507:Ric8a UTSW 7 140858516 missense probably benign 0.03
R4552:Ric8a UTSW 7 140861337 missense probably damaging 1.00
R5500:Ric8a UTSW 7 140858315 missense probably benign 0.43
R6737:Ric8a UTSW 7 140858876 unclassified probably null
Predicted Primers PCR Primer
(F):5'- GCCTCAGCCATATTCACACATTG -3'
(R):5'- TGACAAGTCTTGCCCAGGAC -3'

Sequencing Primer
(F):5'- AGCCATATTCACACATTGACCTCTG -3'
(R):5'- CCAGATAGATAGCTCACTTGCTGG -3'
Posted On2015-06-20