Incidental Mutation 'R4287:Cog1'
ID322070
Institutional Source Beutler Lab
Gene Symbol Cog1
Ensembl Gene ENSMUSG00000018661
Gene Namecomponent of oligomeric golgi complex 1
Synonyms
MMRRC Submission 041652-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.827) question?
Stock #R4287 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location113649169-113667054 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113654027 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 345 (Y345C)
Ref Sequence ENSEMBL: ENSMUSP00000018805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018805] [ENSMUST00000063776] [ENSMUST00000125890] [ENSMUST00000136392] [ENSMUST00000146031] [ENSMUST00000148736] [ENSMUST00000152653]
Predicted Effect probably damaging
Transcript: ENSMUST00000018805
AA Change: Y345C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000018805
Gene: ENSMUSG00000018661
AA Change: Y345C

DomainStartEndE-ValueType
Pfam:Vps51 12 93 1.5e-17 PFAM
low complexity region 95 110 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 518 530 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063776
SMART Domains Protein: ENSMUSP00000068394
Gene: ENSMUSG00000018661

DomainStartEndE-ValueType
Pfam:Vps51 12 93 4.7e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123153
Predicted Effect probably benign
Transcript: ENSMUST00000125890
SMART Domains Protein: ENSMUSP00000115472
Gene: ENSMUSG00000041654

DomainStartEndE-ValueType
Pfam:Zip 7 200 3.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134418
Predicted Effect probably benign
Transcript: ENSMUST00000136392
Predicted Effect probably benign
Transcript: ENSMUST00000142069
Predicted Effect probably benign
Transcript: ENSMUST00000146031
SMART Domains Protein: ENSMUSP00000121286
Gene: ENSMUSG00000041654

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148736
Predicted Effect probably benign
Transcript: ENSMUST00000152653
Meta Mutation Damage Score 0.1213 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of eight proteins (Cog1-8) which form a Golgi-localized complex (COG) required for normal Golgi morphology and function. It is thought that this protein is required for steps in the normal medial and trans Golgi-associated processing of glycoconjugates and plays a role in the organization of the Golgi-localized complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc5 A G 5: 122,800,601 V362A probably benign Het
Ash1l T A 3: 89,066,415 C2594S probably damaging Het
Ccdc82 C A 9: 13,253,418 Q303K probably benign Het
Fpgt T C 3: 155,091,360 probably benign Het
Glrb A T 3: 80,845,232 V408D possibly damaging Het
Gm7135 A G 1: 97,400,398 noncoding transcript Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Itgav G T 2: 83,724,840 E36* probably null Het
Kidins220 G A 12: 25,056,846 E1433K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra3 A G 6: 130,334,302 C39R probably benign Het
Lce1i A G 3: 92,777,435 S145P unknown Het
Memo1 T C 17: 74,255,298 probably null Het
Mpp3 G A 11: 102,023,463 A102V probably damaging Het
Mug2 T A 6: 122,063,673 D727E probably benign Het
Ndufb8 T C 19: 44,552,691 I107V probably benign Het
Olfr186 A T 16: 59,027,613 M98K probably benign Het
Pnn C T 12: 59,072,170 T513I possibly damaging Het
Ric8a A G 7: 140,861,422 Y210C probably damaging Het
Ripor2 G A 13: 24,725,009 V1037M probably damaging Het
Rreb1 A T 13: 37,931,931 T1089S probably benign Het
Rrs1 C T 1: 9,546,215 S231L probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sec23ip A G 7: 128,777,333 D838G probably benign Het
Setbp1 T C 18: 78,859,061 I464V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc41a3 A T 6: 90,640,922 H310L probably benign Het
Smurf1 A G 5: 144,891,458 S363P probably benign Het
Tln1 C T 4: 43,543,509 R1269Q probably benign Het
Tmed3 A G 9: 89,704,898 S10P probably benign Het
Tomm70a T G 16: 57,140,622 Y313D probably damaging Het
Umodl1 A G 17: 30,988,065 E810G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Unc5d T A 8: 28,719,796 Y432F probably benign Het
Vmn2r97 A T 17: 18,948,075 probably benign Het
Zfp629 T C 7: 127,611,938 Y233C probably damaging Het
Zfp986 T C 4: 145,892,518 probably null Het
Other mutations in Cog1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02407:Cog1 APN 11 113654026 missense probably benign 0.02
IGL02631:Cog1 APN 11 113656478 nonsense probably null
IGL03258:Cog1 APN 11 113655093 nonsense probably null
R0243:Cog1 UTSW 11 113656995 unclassified probably benign
R0336:Cog1 UTSW 11 113662250 missense probably benign 0.28
R1061:Cog1 UTSW 11 113652037 missense probably benign
R1539:Cog1 UTSW 11 113652232 missense possibly damaging 0.93
R1757:Cog1 UTSW 11 113652304 missense possibly damaging 0.71
R1782:Cog1 UTSW 11 113653966 missense probably benign
R1924:Cog1 UTSW 11 113656212 missense probably benign
R2120:Cog1 UTSW 11 113649598 missense probably damaging 0.98
R2121:Cog1 UTSW 11 113649598 missense probably damaging 0.98
R2137:Cog1 UTSW 11 113659301 missense probably damaging 1.00
R3809:Cog1 UTSW 11 113655010 missense probably benign
R4042:Cog1 UTSW 11 113661010 missense probably damaging 1.00
R4679:Cog1 UTSW 11 113652290 missense probably damaging 1.00
R4716:Cog1 UTSW 11 113657097 missense probably damaging 1.00
R4774:Cog1 UTSW 11 113657427 missense possibly damaging 0.84
R6575:Cog1 UTSW 11 113656061 missense probably benign 0.36
R7026:Cog1 UTSW 11 113649589 missense probably damaging 1.00
R7233:Cog1 UTSW 11 113649730 missense probably damaging 1.00
R8013:Cog1 UTSW 11 113656164 missense probably damaging 1.00
R8014:Cog1 UTSW 11 113656164 missense probably damaging 1.00
R8027:Cog1 UTSW 11 113652389 missense probably damaging 1.00
Z1176:Cog1 UTSW 11 113651982 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATTTGACCCACCTTCCCAAG -3'
(R):5'- TAAGGGTCCACAGGTAGCAGTG -3'

Sequencing Primer
(F):5'- ATTCTCAGAATGCTGTTCAAAGCCC -3'
(R):5'- AGGTAGCAGTGTGCCCTGAG -3'
Posted On2015-06-20