Mutagenetix > Incidental Mutations

Incidental Mutation 'R4287:Kidins220'

322071

Institutional Source

Beutler Lab

Gene Symbol

Kidins220

Ensembl Gene

ENSMUSG00000036333

Gene Name

kinase D-interacting substrate 220

Synonyms

C330002I19Rik, 3110039L19Rik

MMRRC Submission

041652-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4287 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24974925-25063152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 25056846 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 1433 (E1433K)

Ref Sequence

ENSEMBL: ENSMUSP00000152683 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066652] [ENSMUST00000220459] [ENSMUST00000222941]

Predicted Effect

probably benign
Transcript: ENSMUST00000066652
AA Change: E1463K

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000063999
Gene: ENSMUSG00000036333
AA Change: E1463K

Domain	Start	End	E-Value	Type
ANK	37	66	1.11e-7	SMART
ANK	70	99	2.25e-3	SMART
ANK	103	132	4.78e-7	SMART
ANK	136	165	5.53e-3	SMART
ANK	169	198	2.52e-6	SMART
ANK	202	231	6.26e-2	SMART
ANK	235	264	1.22e-4	SMART
ANK	268	297	6.92e-4	SMART
ANK	301	330	1.57e-2	SMART
ANK	334	363	9.78e-4	SMART
ANK	367	398	4.6e0	SMART
Pfam:KAP_NTPase	440	953	1.2e-112	PFAM
low complexity region	1077	1092	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1382	1396	N/A	INTRINSIC
low complexity region	1422	1452	N/A	INTRINSIC
low complexity region	1509	1520	N/A	INTRINSIC
low complexity region	1544	1555	N/A	INTRINSIC
low complexity region	1561	1567	N/A	INTRINSIC
low complexity region	1596	1609	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220459
AA Change: E1342K

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221622

Predicted Effect

probably benign
Transcript: ENSMUST00000222013

Predicted Effect

probably benign
Transcript: ENSMUST00000222481

Predicted Effect

possibly damaging
Transcript: ENSMUST00000222941
AA Change: E1433K

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)

Meta Mutation Damage Score

0.1215

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is preferentially expressed in the nervous system where it controls neuronal cell survival, differentiation into exons and dendrites, and synaptic plasticity. The encoded protein interacts with membrane receptors, cytosolic signaling components, and cytoskeletal proteins, serving as a scaffold that mediates crosstalk between the neurotrophin pathway and several other intracellular signaling pathways. Aberrant expression of this gene is associated with the onset of various neuropsychiatric disorders and neurodegenerative diseases, including Alzheimer's disease. Naturally occurring mutations in this gene are associated with a syndrome characterized by spastic paraplegia, intellectual disability, nystagmus and obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for a knock-out allele exhibit decreased dendritic complexity in the barrel somatosensory cortex and dentate gyrus neurons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anapc5	A	G	5: 122,800,601	V362A	probably benign	Het
Ash1l	T	A	3: 89,066,415	C2594S	probably damaging	Het
Ccdc82	C	A	9: 13,253,418	Q303K	probably benign	Het
Cog1	A	G	11: 113,654,027	Y345C	probably damaging	Het
Fpgt	T	C	3: 155,091,360		probably benign	Het
Glrb	A	T	3: 80,845,232	V408D	possibly damaging	Het
Gm7135	A	G	1: 97,400,398		noncoding transcript	Het
Il1rn	T	C	2: 24,349,545	L151P	probably damaging	Het
Itgav	G	T	2: 83,724,840	E36*	probably null	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra3	A	G	6: 130,334,302	C39R	probably benign	Het
Lce1i	A	G	3: 92,777,435	S145P	unknown	Het
Memo1	T	C	17: 74,255,298		probably null	Het
Mpp3	G	A	11: 102,023,463	A102V	probably damaging	Het
Mug2	T	A	6: 122,063,673	D727E	probably benign	Het
Ndufb8	T	C	19: 44,552,691	I107V	probably benign	Het
Olfr186	A	T	16: 59,027,613	M98K	probably benign	Het
Pnn	C	T	12: 59,072,170	T513I	possibly damaging	Het
Ric8a	A	G	7: 140,861,422	Y210C	probably damaging	Het
Ripor2	G	A	13: 24,725,009	V1037M	probably damaging	Het
Rreb1	A	T	13: 37,931,931	T1089S	probably benign	Het
Rrs1	C	T	1: 9,546,215	S231L	probably damaging	Het
Rrs1	C	T	1: 9,546,223	R234C	possibly damaging	Het
Sec23ip	A	G	7: 128,777,333	D838G	probably benign	Het
Setbp1	T	C	18: 78,859,061	I464V	probably benign	Het
Slc25a51	C	T	4: 45,399,768	V141M	probably benign	Het
Slc41a3	A	T	6: 90,640,922	H310L	probably benign	Het
Smurf1	A	G	5: 144,891,458	S363P	probably benign	Het
Tln1	C	T	4: 43,543,509	R1269Q	probably benign	Het
Tmed3	A	G	9: 89,704,898	S10P	probably benign	Het
Tomm70a	T	G	16: 57,140,622	Y313D	probably damaging	Het
Umodl1	A	G	17: 30,988,065	E810G	probably benign	Het
Unc5c	T	C	3: 141,714,674	I52T	probably damaging	Het
Unc5d	T	A	8: 28,719,796	Y432F	probably benign	Het
Vmn2r97	A	T	17: 18,948,075		probably benign	Het
Zfp629	T	C	7: 127,611,938	Y233C	probably damaging	Het
Zfp986	T	C	4: 145,892,518		probably null	Het

Other mutations in Kidins220

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Kidins220	APN	12	25038560	splice site	probably benign
IGL00959:Kidins220	APN	12	25051133	missense	possibly damaging	0.74
IGL00978:Kidins220	APN	12	25057474	missense	probably damaging	1.00
IGL01144:Kidins220	APN	12	25010926	missense	probably damaging	1.00
IGL01326:Kidins220	APN	12	25038499	missense	probably damaging	0.97
IGL01545:Kidins220	APN	12	25040460	missense	possibly damaging	0.66
IGL01802:Kidins220	APN	12	24995000	missense	probably damaging	1.00
IGL01875:Kidins220	APN	12	25057729	missense	probably benign	0.00
IGL02160:Kidins220	APN	12	25004111	missense	probably damaging	1.00
IGL02383:Kidins220	APN	12	24997333	splice site	probably benign
IGL02673:Kidins220	APN	12	24994992	missense	probably damaging	1.00
IGL02800:Kidins220	APN	12	25003093	missense	probably damaging	1.00
IGL03345:Kidins220	APN	12	25003045	missense	probably damaging	1.00
IGL03379:Kidins220	APN	12	25008448	missense	probably damaging	0.99
IGL03412:Kidins220	APN	12	24999345	missense	probably damaging	1.00
P0043:Kidins220	UTSW	12	25008156	missense	probably damaging	1.00
R0011:Kidins220	UTSW	12	24999352	missense	probably damaging	0.99
R0011:Kidins220	UTSW	12	24999352	missense	probably damaging	0.99
R0269:Kidins220	UTSW	12	25040512	missense	probably damaging	0.98
R0280:Kidins220	UTSW	12	25010141	missense	probably damaging	1.00
R0334:Kidins220	UTSW	12	25008069	missense	probably damaging	1.00
R1601:Kidins220	UTSW	12	25005088	missense	probably benign	0.35
R1778:Kidins220	UTSW	12	25013446	splice site	probably benign
R1808:Kidins220	UTSW	12	25003009	missense	probably benign	0.00
R1855:Kidins220	UTSW	12	25056591	missense	probably damaging	1.00
R1965:Kidins220	UTSW	12	24994906	missense	probably damaging	1.00
R1982:Kidins220	UTSW	12	25051194	missense	probably benign	0.01
R2069:Kidins220	UTSW	12	24987006	splice site	probably benign
R2101:Kidins220	UTSW	12	25057423	missense	probably damaging	1.00
R2124:Kidins220	UTSW	12	25041303	critical splice donor site	probably null
R2371:Kidins220	UTSW	12	25057324	missense	probably damaging	1.00
R2405:Kidins220	UTSW	12	25011509	missense	probably damaging	0.99
R3522:Kidins220	UTSW	12	24990758	missense	probably damaging	1.00
R3877:Kidins220	UTSW	12	25001565	splice site	probably benign
R3915:Kidins220	UTSW	12	25053958	missense	possibly damaging	0.93
R4023:Kidins220	UTSW	12	25057144	splice site	probably null
R4476:Kidins220	UTSW	12	25011001	missense	probably damaging	1.00
R4495:Kidins220	UTSW	12	25038302	splice site	probably null
R4627:Kidins220	UTSW	12	25057042	missense	possibly damaging	0.89
R4807:Kidins220	UTSW	12	25057285	missense	probably damaging	1.00
R4899:Kidins220	UTSW	12	25013443	critical splice donor site	probably null
R4960:Kidins220	UTSW	12	24992260	nonsense	probably null
R5118:Kidins220	UTSW	12	24992297	missense	probably damaging	1.00
R5183:Kidins220	UTSW	12	25051126	missense	probably benign	0.17
R5238:Kidins220	UTSW	12	25003010	missense	probably benign	0.31
R5580:Kidins220	UTSW	12	25047897	missense	probably benign	0.00
R5707:Kidins220	UTSW	12	25013391	missense	probably damaging	1.00
R5813:Kidins220	UTSW	12	25057140	nonsense	probably null
R6131:Kidins220	UTSW	12	24992314	splice site	probably null
R6146:Kidins220	UTSW	12	25052813	missense	probably damaging	1.00
R6151:Kidins220	UTSW	12	25056909	missense	possibly damaging	0.65
R6160:Kidins220	UTSW	12	24997311	missense	probably damaging	1.00
R6187:Kidins220	UTSW	12	25051308	splice site	probably null
R6289:Kidins220	UTSW	12	25056616	missense	probably damaging	1.00
R6321:Kidins220	UTSW	12	25057534	missense	probably benign	0.09
R6450:Kidins220	UTSW	12	25057191	missense	probably benign
R6513:Kidins220	UTSW	12	25038435	missense	possibly damaging	0.94
R6652:Kidins220	UTSW	12	25010060	splice site	probably null
R6711:Kidins220	UTSW	12	24998751	missense	probably damaging	0.96
R6858:Kidins220	UTSW	12	25008543	missense	possibly damaging	0.85
R7102:Kidins220	UTSW	12	25057663	missense	probably benign	0.00
R7112:Kidins220	UTSW	12	25004019	missense	probably damaging	1.00
R7139:Kidins220	UTSW	12	24994821	missense	probably damaging	1.00
R7140:Kidins220	UTSW	12	25036624	missense	probably damaging	1.00
R7271:Kidins220	UTSW	12	25011571	missense	probably benign	0.21
R7361:Kidins220	UTSW	12	25057000	missense	probably benign	0.01
R7509:Kidins220	UTSW	12	24982361	missense	probably damaging	0.98
R7510:Kidins220	UTSW	12	24992269	missense	possibly damaging	0.88
R7783:Kidins220	UTSW	12	24988556	missense	probably damaging	1.00
R7796:Kidins220	UTSW	12	24982351	missense	probably damaging	0.96
R7831:Kidins220	UTSW	12	25061231	missense	possibly damaging	0.90
R8074:Kidins220	UTSW	12	25057716	missense	probably benign	0.29
R8214:Kidins220	UTSW	12	24994855	missense	probably damaging	1.00
R8304:Kidins220	UTSW	12	25057128	missense	probably benign	0.01
R8313:Kidins220	UTSW	12	25004111	missense	probably damaging	1.00
R8346:Kidins220	UTSW	12	25036534	missense	probably damaging	1.00
R8392:Kidins220	UTSW	12	24990728	missense	probably damaging	1.00
R8482:Kidins220	UTSW	12	25040528	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTCAATTCCCAGGACTCCAG -3'
(R):5'- AAGACTTCTTGCCTGGGAGC -3'

Sequencing Primer
(F):5'- CTTACTGATAAGGTGCAGGCC -3'
(R):5'- AGCAGCTTACTACCTGACTGG -3'

Posted On

2015-06-20