Incidental Mutation 'R4287:Pnn'
ID322072
Institutional Source Beutler Lab
Gene Symbol Pnn
Ensembl Gene ENSMUSG00000020994
Gene Namepinin
SynonymsD12Ertd512e
MMRRC Submission 041652-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4287 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location59066884-59073998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59072170 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 513 (T513I)
Ref Sequence ENSEMBL: ENSMUSP00000021381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021381] [ENSMUST00000219176]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021381
AA Change: T513I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021381
Gene: ENSMUSG00000020994
AA Change: T513I

DomainStartEndE-ValueType
Pfam:Pinin_SDK_N 1 132 3.7e-61 PFAM
Pfam:Pinin_SDK_memA 136 261 7.8e-38 PFAM
coiled coil region 290 374 N/A INTRINSIC
low complexity region 451 508 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
internal_repeat_1 559 572 9.16e-7 PROSPERO
internal_repeat_1 563 576 9.16e-7 PROSPERO
low complexity region 579 647 N/A INTRINSIC
low complexity region 651 665 N/A INTRINSIC
low complexity region 671 682 N/A INTRINSIC
low complexity region 695 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217773
Predicted Effect probably benign
Transcript: ENSMUST00000219176
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die prior to implantation. Mice homozygous for a hypomorphic allele show complete perinatal lethality, edema, axial skeletal abnormalities, cardiac outflow tract defects, cleft palate, and impaired development of the dorsal dermis and brown fat tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc5 A G 5: 122,800,601 V362A probably benign Het
Ash1l T A 3: 89,066,415 C2594S probably damaging Het
Ccdc82 C A 9: 13,253,418 Q303K probably benign Het
Cog1 A G 11: 113,654,027 Y345C probably damaging Het
Fpgt T C 3: 155,091,360 probably benign Het
Glrb A T 3: 80,845,232 V408D possibly damaging Het
Gm7135 A G 1: 97,400,398 noncoding transcript Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Itgav G T 2: 83,724,840 E36* probably null Het
Kidins220 G A 12: 25,056,846 E1433K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra3 A G 6: 130,334,302 C39R probably benign Het
Lce1i A G 3: 92,777,435 S145P unknown Het
Memo1 T C 17: 74,255,298 probably null Het
Mpp3 G A 11: 102,023,463 A102V probably damaging Het
Mug2 T A 6: 122,063,673 D727E probably benign Het
Ndufb8 T C 19: 44,552,691 I107V probably benign Het
Olfr186 A T 16: 59,027,613 M98K probably benign Het
Ric8a A G 7: 140,861,422 Y210C probably damaging Het
Ripor2 G A 13: 24,725,009 V1037M probably damaging Het
Rreb1 A T 13: 37,931,931 T1089S probably benign Het
Rrs1 C T 1: 9,546,215 S231L probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sec23ip A G 7: 128,777,333 D838G probably benign Het
Setbp1 T C 18: 78,859,061 I464V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc41a3 A T 6: 90,640,922 H310L probably benign Het
Smurf1 A G 5: 144,891,458 S363P probably benign Het
Tln1 C T 4: 43,543,509 R1269Q probably benign Het
Tmed3 A G 9: 89,704,898 S10P probably benign Het
Tomm70a T G 16: 57,140,622 Y313D probably damaging Het
Umodl1 A G 17: 30,988,065 E810G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Unc5d T A 8: 28,719,796 Y432F probably benign Het
Vmn2r97 A T 17: 18,948,075 probably benign Het
Zfp629 T C 7: 127,611,938 Y233C probably damaging Het
Zfp986 T C 4: 145,892,518 probably null Het
Other mutations in Pnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02267:Pnn APN 12 59070209 missense probably damaging 1.00
R0350:Pnn UTSW 12 59067117 critical splice donor site probably null
R1853:Pnn UTSW 12 59071613 missense probably damaging 0.99
R1854:Pnn UTSW 12 59071613 missense probably damaging 0.99
R4792:Pnn UTSW 12 59072205 missense possibly damaging 0.86
R4812:Pnn UTSW 12 59071618 missense possibly damaging 0.94
R4933:Pnn UTSW 12 59070227 missense probably damaging 1.00
R5541:Pnn UTSW 12 59071930 missense possibly damaging 0.50
R5716:Pnn UTSW 12 59071872 missense probably benign 0.00
R5781:Pnn UTSW 12 59071819 missense probably damaging 0.99
R5963:Pnn UTSW 12 59067831 nonsense probably null
R6877:Pnn UTSW 12 59068767 missense probably damaging 1.00
R6999:Pnn UTSW 12 59070299 critical splice donor site probably null
R7372:Pnn UTSW 12 59068979 missense probably damaging 1.00
R7458:Pnn UTSW 12 59072414 missense unknown
R7535:Pnn UTSW 12 59072137 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATCTCTTTCTCCTGGAAAAGAGA -3'
(R):5'- ATCTCGGTTATGTCCTCGGC -3'

Sequencing Primer
(F):5'- TTCTCAGGAAGTGGAAAAGGAGTCTG -3'
(R):5'- TAGAGCTGCTACTGGAACTACTGC -3'
Posted On2015-06-20