Incidental Mutation 'R4287:Tomm70a'
ID322075
Institutional Source Beutler Lab
Gene Symbol Tomm70a
Ensembl Gene ENSMUSG00000022752
Gene Nametranslocase of outer mitochondrial membrane 70A
SynonymsTomm70a, D16Wsu109e, D16Ium22e, Tom70, 2610044B22Rik, D16Ium22
MMRRC Submission 041652-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R4287 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location57121703-57156705 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 57140622 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 313 (Y313D)
Ref Sequence ENSEMBL: ENSMUSP00000129186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166897]
Predicted Effect probably damaging
Transcript: ENSMUST00000166897
AA Change: Y313D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129186
Gene: ENSMUSG00000022752
AA Change: Y313D

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 45 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 98 108 N/A INTRINSIC
TPR 117 150 1.04e-7 SMART
TPR 156 189 1.97e-3 SMART
TPR 190 223 1.6e1 SMART
low complexity region 278 291 N/A INTRINSIC
TPR 332 365 1.17e1 SMART
TPR 370 403 3.5e0 SMART
TPR 404 437 3.32e-1 SMART
TPR 445 478 7.49e1 SMART
TPR 479 512 9.39e-1 SMART
TPR 513 547 9.48e1 SMART
TPR 548 581 4.03e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231298
Meta Mutation Damage Score 0.412 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an import receptor of the outer mitochondrial membrane that is part of the translocase of the outer membrane complex. This protein is involved in the import of mitochondrial precursor proteins. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc5 A G 5: 122,800,601 V362A probably benign Het
Ash1l T A 3: 89,066,415 C2594S probably damaging Het
Ccdc82 C A 9: 13,253,418 Q303K probably benign Het
Cog1 A G 11: 113,654,027 Y345C probably damaging Het
Fpgt T C 3: 155,091,360 probably benign Het
Glrb A T 3: 80,845,232 V408D possibly damaging Het
Gm7135 A G 1: 97,400,398 noncoding transcript Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Itgav G T 2: 83,724,840 E36* probably null Het
Kidins220 G A 12: 25,056,846 E1433K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra3 A G 6: 130,334,302 C39R probably benign Het
Lce1i A G 3: 92,777,435 S145P unknown Het
Memo1 T C 17: 74,255,298 probably null Het
Mpp3 G A 11: 102,023,463 A102V probably damaging Het
Mug2 T A 6: 122,063,673 D727E probably benign Het
Ndufb8 T C 19: 44,552,691 I107V probably benign Het
Olfr186 A T 16: 59,027,613 M98K probably benign Het
Pnn C T 12: 59,072,170 T513I possibly damaging Het
Ric8a A G 7: 140,861,422 Y210C probably damaging Het
Ripor2 G A 13: 24,725,009 V1037M probably damaging Het
Rreb1 A T 13: 37,931,931 T1089S probably benign Het
Rrs1 C T 1: 9,546,215 S231L probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sec23ip A G 7: 128,777,333 D838G probably benign Het
Setbp1 T C 18: 78,859,061 I464V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc41a3 A T 6: 90,640,922 H310L probably benign Het
Smurf1 A G 5: 144,891,458 S363P probably benign Het
Tln1 C T 4: 43,543,509 R1269Q probably benign Het
Tmed3 A G 9: 89,704,898 S10P probably benign Het
Umodl1 A G 17: 30,988,065 E810G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Unc5d T A 8: 28,719,796 Y432F probably benign Het
Vmn2r97 A T 17: 18,948,075 probably benign Het
Zfp629 T C 7: 127,611,938 Y233C probably damaging Het
Zfp986 T C 4: 145,892,518 probably null Het
Other mutations in Tomm70a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Tomm70a APN 16 57149810 splice site probably benign
IGL01064:Tomm70a APN 16 57152612 missense probably damaging 0.99
IGL01597:Tomm70a APN 16 57133188 missense probably benign 0.00
IGL02248:Tomm70a APN 16 57138102 missense probably benign 0.33
IGL02560:Tomm70a APN 16 57149849 missense probably benign 0.33
IGL03328:Tomm70a APN 16 57144787 missense probably damaging 0.99
IGL03335:Tomm70a APN 16 57149926 missense probably damaging 1.00
R0164:Tomm70a UTSW 16 57147821 missense probably damaging 0.96
R0164:Tomm70a UTSW 16 57147821 missense probably damaging 0.96
R0196:Tomm70a UTSW 16 57146100 missense probably benign 0.03
R0417:Tomm70a UTSW 16 57149903 missense probably benign 0.28
R0763:Tomm70a UTSW 16 57122172 missense probably benign 0.30
R1099:Tomm70a UTSW 16 57142817 missense probably damaging 1.00
R1680:Tomm70a UTSW 16 57121961 missense unknown
R2081:Tomm70a UTSW 16 57140758 missense probably damaging 0.99
R2127:Tomm70a UTSW 16 57121871 missense unknown
R3033:Tomm70a UTSW 16 57122025 missense probably damaging 1.00
R5029:Tomm70a UTSW 16 57122151 missense probably benign
R5210:Tomm70a UTSW 16 57133251 critical splice donor site probably null
R5214:Tomm70a UTSW 16 57121937 missense unknown
R5586:Tomm70a UTSW 16 57122130 missense probably damaging 1.00
R5744:Tomm70a UTSW 16 57121839 start gained probably benign
R5872:Tomm70a UTSW 16 57144742 missense probably benign 0.06
R6256:Tomm70a UTSW 16 57152692 missense probably benign 0.05
R6699:Tomm70a UTSW 16 57142802 missense probably benign 0.02
R6902:Tomm70a UTSW 16 57138081 missense probably damaging 0.96
R7106:Tomm70a UTSW 16 57140758 missense probably damaging 0.99
R7378:Tomm70a UTSW 16 57146044 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGTTTAATCTCTAACCCCAGTTC -3'
(R):5'- GCCAAAGTAACCATGGTCCC -3'

Sequencing Primer
(F):5'- AATCTCTAACCCCAGTTCCAGTC -3'
(R):5'- AGTAACCATGGTCCCGTTCTAAC -3'
Posted On2015-06-20