Incidental Mutation 'R4287:Memo1'
ID322079
Institutional Source Beutler Lab
Gene Symbol Memo1
Ensembl Gene ENSMUSG00000058704
Gene Namemediator of cell motility 1
Synonyms0610016J10Rik, D930048L02Rik
MMRRC Submission 041652-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4287 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location74200706-74294883 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 74255298 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078459] [ENSMUST00000078459]
Predicted Effect probably null
Transcript: ENSMUST00000078459
SMART Domains Protein: ENSMUSP00000077553
Gene: ENSMUSG00000058704

DomainStartEndE-ValueType
Pfam:Memo 9 293 3.7e-84 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000078459
SMART Domains Protein: ENSMUSP00000077553
Gene: ENSMUSG00000058704

DomainStartEndE-ValueType
Pfam:Memo 9 293 3.7e-84 PFAM
Meta Mutation Damage Score 0.522 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a floxed allele activated postnatally exhibit a reduced life span, increased insulin sensitivity, small stature, graying hair, alopecia, kyphosis, loss of subcutaneous fat, loss of spermatozoa in the epididymis and increased active vitamin D. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc5 A G 5: 122,800,601 V362A probably benign Het
Ash1l T A 3: 89,066,415 C2594S probably damaging Het
Ccdc82 C A 9: 13,253,418 Q303K probably benign Het
Cog1 A G 11: 113,654,027 Y345C probably damaging Het
Fpgt T C 3: 155,091,360 probably benign Het
Glrb A T 3: 80,845,232 V408D possibly damaging Het
Gm7135 A G 1: 97,400,398 noncoding transcript Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Itgav G T 2: 83,724,840 E36* probably null Het
Kidins220 G A 12: 25,056,846 E1433K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra3 A G 6: 130,334,302 C39R probably benign Het
Lce1i A G 3: 92,777,435 S145P unknown Het
Mpp3 G A 11: 102,023,463 A102V probably damaging Het
Mug2 T A 6: 122,063,673 D727E probably benign Het
Ndufb8 T C 19: 44,552,691 I107V probably benign Het
Olfr186 A T 16: 59,027,613 M98K probably benign Het
Pnn C T 12: 59,072,170 T513I possibly damaging Het
Ric8a A G 7: 140,861,422 Y210C probably damaging Het
Ripor2 G A 13: 24,725,009 V1037M probably damaging Het
Rreb1 A T 13: 37,931,931 T1089S probably benign Het
Rrs1 C T 1: 9,546,215 S231L probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sec23ip A G 7: 128,777,333 D838G probably benign Het
Setbp1 T C 18: 78,859,061 I464V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc41a3 A T 6: 90,640,922 H310L probably benign Het
Smurf1 A G 5: 144,891,458 S363P probably benign Het
Tln1 C T 4: 43,543,509 R1269Q probably benign Het
Tmed3 A G 9: 89,704,898 S10P probably benign Het
Tomm70a T G 16: 57,140,622 Y313D probably damaging Het
Umodl1 A G 17: 30,988,065 E810G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Unc5d T A 8: 28,719,796 Y432F probably benign Het
Vmn2r97 A T 17: 18,948,075 probably benign Het
Zfp629 T C 7: 127,611,938 Y233C probably damaging Het
Zfp986 T C 4: 145,892,518 probably null Het
Other mutations in Memo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Memo1 APN 17 74241981 nonsense probably null
IGL01570:Memo1 APN 17 74217108 splice site probably benign
IGL02709:Memo1 APN 17 74245032 missense probably damaging 1.00
IGL03172:Memo1 APN 17 74245001 missense probably damaging 1.00
R0067:Memo1 UTSW 17 74225458 missense probably damaging 1.00
R1068:Memo1 UTSW 17 74225555 missense probably damaging 1.00
R1962:Memo1 UTSW 17 74245008 missense possibly damaging 0.54
R1964:Memo1 UTSW 17 74245008 missense possibly damaging 0.54
R2029:Memo1 UTSW 17 74245054 missense probably null 0.99
R3236:Memo1 UTSW 17 74202352 missense probably damaging 1.00
R4284:Memo1 UTSW 17 74255298 critical splice acceptor site probably null
R4285:Memo1 UTSW 17 74255298 critical splice acceptor site probably null
R4427:Memo1 UTSW 17 74202307 missense probably benign 0.01
R4583:Memo1 UTSW 17 74258461 nonsense probably null
R4607:Memo1 UTSW 17 74258461 nonsense probably null
R4608:Memo1 UTSW 17 74258461 nonsense probably null
R6118:Memo1 UTSW 17 74202307 missense possibly damaging 0.52
R6769:Memo1 UTSW 17 74201278 missense probably damaging 1.00
R6771:Memo1 UTSW 17 74201278 missense probably damaging 1.00
R7226:Memo1 UTSW 17 74202343 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGTAGACTTTCAGACCAAGG -3'
(R):5'- AACAATTGCGTGTTCTCTACTACCTTG -3'

Sequencing Primer
(F):5'- GTGTCAGAATGAAACATTTGACAAC -3'
(R):5'- GCGTGTTCTCTACTACCTTGTAAAG -3'
Posted On2015-06-20