Mutagenetix > Incidental Mutations

Incidental Mutation 'R4287:Setbp1'

322080

Institutional Source

Beutler Lab

Gene Symbol

Setbp1

Ensembl Gene

ENSMUSG00000024548

Gene Name

SET binding protein 1

Synonyms

Seb

MMRRC Submission

041652-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.516) question?

Stock #

R4287 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78750380-79109391 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 78859061 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 464 (I464V)

Ref Sequence

ENSEMBL: ENSMUSP00000025430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025430]

Predicted Effect

probably benign
Transcript: ENSMUST00000025430
AA Change: I464V

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: I464V

Domain	Start	End	E-Value	Type
low complexity region	155	165	N/A	INTRINSIC
low complexity region	221	251	N/A	INTRINSIC
low complexity region	278	286	N/A	INTRINSIC
AT_hook	528	540	4.64e-1	SMART
low complexity region	565	571	N/A	INTRINSIC
low complexity region	594	617	N/A	INTRINSIC
low complexity region	878	887	N/A	INTRINSIC
AT_hook	960	972	1.89e-1	SMART
low complexity region	1086	1103	N/A	INTRINSIC
low complexity region	1316	1337	N/A	INTRINSIC
AT_hook	1393	1405	7.27e-1	SMART
low complexity region	1462	1486	N/A	INTRINSIC
low complexity region	1498	1514	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161465
AA Change: I464V

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000124497
Gene: ENSMUSG00000024548
AA Change: I464V

Domain	Start	End	E-Value	Type
low complexity region	46	55	N/A	INTRINSIC
low complexity region	202	212	N/A	INTRINSIC
low complexity region	268	298	N/A	INTRINSIC
low complexity region	325	333	N/A	INTRINSIC
AT_hook	575	587	4.64e-1	SMART
low complexity region	612	618	N/A	INTRINSIC
low complexity region	641	664	N/A	INTRINSIC
low complexity region	925	934	N/A	INTRINSIC
AT_hook	1007	1019	1.89e-1	SMART
low complexity region	1133	1150	N/A	INTRINSIC
low complexity region	1363	1384	N/A	INTRINSIC
AT_hook	1440	1452	7.27e-1	SMART
low complexity region	1509	1533	N/A	INTRINSIC
low complexity region	1545	1561	N/A	INTRINSIC

Meta Mutation Damage Score

0.0592

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anapc5	A	G	5: 122,800,601	V362A	probably benign	Het
Ash1l	T	A	3: 89,066,415	C2594S	probably damaging	Het
Ccdc82	C	A	9: 13,253,418	Q303K	probably benign	Het
Cog1	A	G	11: 113,654,027	Y345C	probably damaging	Het
Fpgt	T	C	3: 155,091,360		probably benign	Het
Glrb	A	T	3: 80,845,232	V408D	possibly damaging	Het
Gm7135	A	G	1: 97,400,398		noncoding transcript	Het
Il1rn	T	C	2: 24,349,545	L151P	probably damaging	Het
Itgav	G	T	2: 83,724,840	E36*	probably null	Het
Kidins220	G	A	12: 25,056,846	E1433K	possibly damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra3	A	G	6: 130,334,302	C39R	probably benign	Het
Lce1i	A	G	3: 92,777,435	S145P	unknown	Het
Memo1	T	C	17: 74,255,298		probably null	Het
Mpp3	G	A	11: 102,023,463	A102V	probably damaging	Het
Mug2	T	A	6: 122,063,673	D727E	probably benign	Het
Ndufb8	T	C	19: 44,552,691	I107V	probably benign	Het
Olfr186	A	T	16: 59,027,613	M98K	probably benign	Het
Pnn	C	T	12: 59,072,170	T513I	possibly damaging	Het
Ric8a	A	G	7: 140,861,422	Y210C	probably damaging	Het
Ripor2	G	A	13: 24,725,009	V1037M	probably damaging	Het
Rreb1	A	T	13: 37,931,931	T1089S	probably benign	Het
Rrs1	C	T	1: 9,546,215	S231L	probably damaging	Het
Rrs1	C	T	1: 9,546,223	R234C	possibly damaging	Het
Sec23ip	A	G	7: 128,777,333	D838G	probably benign	Het
Slc25a51	C	T	4: 45,399,768	V141M	probably benign	Het
Slc41a3	A	T	6: 90,640,922	H310L	probably benign	Het
Smurf1	A	G	5: 144,891,458	S363P	probably benign	Het
Tln1	C	T	4: 43,543,509	R1269Q	probably benign	Het
Tmed3	A	G	9: 89,704,898	S10P	probably benign	Het
Tomm70a	T	G	16: 57,140,622	Y313D	probably damaging	Het
Umodl1	A	G	17: 30,988,065	E810G	probably benign	Het
Unc5c	T	C	3: 141,714,674	I52T	probably damaging	Het
Unc5d	T	A	8: 28,719,796	Y432F	probably benign	Het
Vmn2r97	A	T	17: 18,948,075		probably benign	Het
Zfp629	T	C	7: 127,611,938	Y233C	probably damaging	Het
Zfp986	T	C	4: 145,892,518		probably null	Het

Other mutations in Setbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Setbp1	APN	18	78755679	nonsense	probably null	0.00
IGL00668:Setbp1	APN	18	78857770	missense	probably damaging	1.00
IGL01628:Setbp1	APN	18	78856777	missense	probably damaging	1.00
IGL02084:Setbp1	APN	18	78857410	missense	probably damaging	1.00
IGL02405:Setbp1	APN	18	78857299	missense	probably damaging	1.00
IGL02427:Setbp1	APN	18	78857473	missense	probably damaging	1.00
IGL02612:Setbp1	APN	18	78755710	missense	probably damaging	1.00
IGL02725:Setbp1	APN	18	78857374	nonsense	probably null
IGL03005:Setbp1	APN	18	78859125	missense	possibly damaging	0.75
IGL03123:Setbp1	APN	18	78857009	missense	probably damaging	1.00
R1083:Setbp1	UTSW	18	78857626	missense	probably damaging	1.00
R1110:Setbp1	UTSW	18	78857860	missense	probably damaging	1.00
R1167:Setbp1	UTSW	18	78857236	missense	possibly damaging	0.85
R1221:Setbp1	UTSW	18	78856583	missense	probably damaging	1.00
R1225:Setbp1	UTSW	18	78858208	missense	probably damaging	0.99
R1327:Setbp1	UTSW	18	78783358	missense	probably benign	0.00
R1481:Setbp1	UTSW	18	78783301	missense	probably benign	0.01
R1482:Setbp1	UTSW	18	79086835	missense	probably damaging	1.00
R1496:Setbp1	UTSW	18	78859912	missense	probably damaging	1.00
R1550:Setbp1	UTSW	18	78858592	missense	probably damaging	1.00
R1708:Setbp1	UTSW	18	78858467	missense	probably damaging	0.99
R1751:Setbp1	UTSW	18	78857398	missense	probably damaging	1.00
R1922:Setbp1	UTSW	18	78858362	missense	possibly damaging	0.75
R1986:Setbp1	UTSW	18	78858544	missense	probably damaging	0.99
R2090:Setbp1	UTSW	18	78856720	missense	probably benign	0.00
R2851:Setbp1	UTSW	18	78923996	missense	probably benign	0.11
R2853:Setbp1	UTSW	18	78923996	missense	probably benign	0.11
R2941:Setbp1	UTSW	18	78858197	missense	probably damaging	1.00
R3151:Setbp1	UTSW	18	78857435	missense	probably damaging	1.00
R3156:Setbp1	UTSW	18	78859303	missense	probably benign	0.00
R3807:Setbp1	UTSW	18	78783322	missense	probably benign	0.01
R4133:Setbp1	UTSW	18	78856991	missense	probably benign	0.05
R4345:Setbp1	UTSW	18	79086579	missense	probably damaging	0.99
R4374:Setbp1	UTSW	18	78859922	missense	probably damaging	0.97
R4377:Setbp1	UTSW	18	78859922	missense	probably damaging	0.97
R4378:Setbp1	UTSW	18	78856618	missense	possibly damaging	0.95
R4379:Setbp1	UTSW	18	79086681	missense	probably damaging	1.00
R4585:Setbp1	UTSW	18	79086949	missense	probably benign	0.00
R4595:Setbp1	UTSW	18	78857516	missense	probably benign	0.00
R4817:Setbp1	UTSW	18	78858800	missense	probably damaging	1.00
R4971:Setbp1	UTSW	18	78858167	missense	probably benign	0.07
R4976:Setbp1	UTSW	18	79086712	missense	probably damaging	1.00
R5017:Setbp1	UTSW	18	78856594	missense	possibly damaging	0.81
R5066:Setbp1	UTSW	18	78857299	missense	probably damaging	1.00
R5133:Setbp1	UTSW	18	78857482	missense	probably damaging	1.00
R5151:Setbp1	UTSW	18	78857999	missense	probably damaging	1.00
R5237:Setbp1	UTSW	18	78856975	missense	possibly damaging	0.92
R5480:Setbp1	UTSW	18	78858063	missense	probably damaging	0.99
R5507:Setbp1	UTSW	18	79086712	missense	probably damaging	1.00
R5529:Setbp1	UTSW	18	79086652	missense	probably damaging	0.99
R5622:Setbp1	UTSW	18	78857485	missense	probably damaging	1.00
R5722:Setbp1	UTSW	18	78856645	missense	possibly damaging	0.95
R5806:Setbp1	UTSW	18	78856482	unclassified	probably null
R5940:Setbp1	UTSW	18	78755488	missense	probably damaging	1.00
R6025:Setbp1	UTSW	18	78859240	missense	probably damaging	0.98
R6030:Setbp1	UTSW	18	78857711	missense	probably benign	0.02
R6030:Setbp1	UTSW	18	78857711	missense	probably benign	0.02
R6250:Setbp1	UTSW	18	78858002	missense	probably benign	0.00
R6256:Setbp1	UTSW	18	78857257	missense	probably damaging	1.00
R6332:Setbp1	UTSW	18	78783369	missense	probably benign	0.21
R6522:Setbp1	UTSW	18	78857390	missense	probably damaging	0.98
R6873:Setbp1	UTSW	18	78859559	missense	probably benign	0.00
R6886:Setbp1	UTSW	18	78857500	missense	probably damaging	1.00
R6986:Setbp1	UTSW	18	78857839	missense	probably damaging	1.00
R7042:Setbp1	UTSW	18	79086855	missense	probably damaging	1.00
R7131:Setbp1	UTSW	18	79086960	missense	probably benign	0.08
R7134:Setbp1	UTSW	18	78859519	missense	possibly damaging	0.86
R7215:Setbp1	UTSW	18	78856837	missense	probably damaging	0.97
R7219:Setbp1	UTSW	18	78755745	missense	probably damaging	1.00
R7378:Setbp1	UTSW	18	78857486	missense	probably damaging	1.00
R7461:Setbp1	UTSW	18	78856492	missense	probably benign	0.06
R7589:Setbp1	UTSW	18	78856492	missense	probably benign	0.01
R7840:Setbp1	UTSW	18	78783424	missense	probably benign	0.03
R7849:Setbp1	UTSW	18	78856853	missense	probably benign	0.00
R7923:Setbp1	UTSW	18	78783424	missense	probably benign	0.03
R7932:Setbp1	UTSW	18	78856853	missense	probably benign	0.00
Z1088:Setbp1	UTSW	18	78859594	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CAAACTTGGGGTGCTGGATC -3'
(R):5'- GAAAATGATTCCAGTCATGTCCGG -3'

Sequencing Primer
(F):5'- ATCTCAGACAGCTTTCCTGATGGAG -3'
(R):5'- TGTCCGGATTACTATCCCCATAAAG -3'

Posted On

2015-06-20