Incidental Mutation 'R0001:Nyap2'
ID32209
Institutional Source Beutler Lab
Gene Symbol Nyap2
Ensembl Gene ENSMUSG00000054976
Gene Nameneuronal tyrosine-phophorylated phosphoinositide 3-kinase adaptor 2
SynonymsJr6, 9430031J16Rik
MMRRC Submission 038297-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0001 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location81076950-81341764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81192107 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 193 (H193L)
Ref Sequence ENSEMBL: ENSMUSP00000117661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068275] [ENSMUST00000113494] [ENSMUST00000123285] [ENSMUST00000123720] [ENSMUST00000137862]
Predicted Effect probably benign
Transcript: ENSMUST00000068275
AA Change: H193L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000065468
Gene: ENSMUSG00000054976
AA Change: H193L

DomainStartEndE-ValueType
Pfam:NYAP_N 44 447 1.5e-139 PFAM
Pfam:NYAP_C 496 709 5.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113494
SMART Domains Protein: ENSMUSP00000109122
Gene: ENSMUSG00000054976

DomainStartEndE-ValueType
Pfam:NYAP_N 43 416 1.4e-134 PFAM
Pfam:NYAP_C 420 647 7.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123285
SMART Domains Protein: ENSMUSP00000122935
Gene: ENSMUSG00000054976

DomainStartEndE-ValueType
Pfam:NYAP_N 43 416 1.9e-134 PFAM
Pfam:NYAP_C 420 716 6.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123720
AA Change: H193L

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000117661
Gene: ENSMUSG00000054976
AA Change: H193L

DomainStartEndE-ValueType
Pfam:NYAP_N 43 448 1.9e-127 PFAM
low complexity region 489 510 N/A INTRINSIC
low complexity region 549 564 N/A INTRINSIC
low complexity region 649 662 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137862
SMART Domains Protein: ENSMUSP00000120767
Gene: ENSMUSG00000054976

DomainStartEndE-ValueType
Pfam:NYAP_N 43 416 1.4e-134 PFAM
Pfam:NYAP_C 420 647 7.7e-17 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (76/77)
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik G A 19: 58,789,171 A61V probably damaging Het
2900092C05Rik T A 7: 12,554,607 probably benign Het
A4galt A G 15: 83,228,289 F98L probably benign Het
Abca4 T G 3: 122,081,011 probably benign Het
Acacb C T 5: 114,204,833 probably benign Het
Agbl1 A T 7: 76,419,863 H367L probably damaging Het
Apoa4 C A 9: 46,242,892 Q264K probably benign Het
Camsap2 A T 1: 136,282,888 probably benign Het
Cdan1 C A 2: 120,723,751 R939L probably benign Het
Ceacam18 G A 7: 43,636,876 V58I possibly damaging Het
Ciita A T 16: 10,514,433 probably benign Het
Clk4 T A 11: 51,268,765 probably benign Het
Cntnap2 T C 6: 46,530,171 D215G probably benign Het
Col11a2 T C 17: 34,061,612 S1218P probably benign Het
Col20a1 T C 2: 180,984,412 probably benign Het
Ctsb A G 14: 63,135,622 E76G probably benign Het
Ctu2 T C 8: 122,478,920 C161R probably benign Het
Dhx29 T C 13: 112,964,556 L1211P probably damaging Het
Dhx9 G T 1: 153,462,636 T759K probably damaging Het
Dmxl1 T C 18: 49,888,897 probably benign Het
Dpysl3 C T 18: 43,358,375 E226K possibly damaging Het
Eif2d A T 1: 131,168,127 K453* probably null Het
Epha7 T C 4: 28,961,279 probably benign Het
Fam160b1 T A 19: 57,381,756 H477Q probably benign Het
Fat3 T C 9: 16,377,873 D118G probably damaging Het
Foxn4 T A 5: 114,260,870 Q159L probably damaging Het
Frs2 G T 10: 117,074,876 H194N possibly damaging Het
Fut8 A T 12: 77,475,315 *576L probably null Het
Galns T C 8: 122,595,883 probably benign Het
Gamt G A 10: 80,259,061 probably benign Het
Gpn1 T A 5: 31,495,617 probably benign Het
Ipcef1 G T 10: 6,900,600 H330Q probably damaging Het
Itga4 A C 2: 79,326,587 Y1024S probably damaging Het
Jak2 A G 19: 29,282,387 I229V probably benign Het
Katnal1 A G 5: 148,921,275 S42P probably damaging Het
Kcnu1 A T 8: 25,859,270 D142V probably damaging Het
Lig3 C T 11: 82,790,591 R470W probably damaging Het
Mgat4c A G 10: 102,388,956 S344G probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mipol1 C T 12: 57,460,839 probably benign Het
Mki67 C T 7: 135,699,172 V1378M probably damaging Het
Mki67 T A 7: 135,701,019 D762V probably damaging Het
Mmp9 A G 2: 164,948,383 T43A probably benign Het
Muc6 T C 7: 141,641,574 T1316A possibly damaging Het
Naip5 A G 13: 100,214,650 probably null Het
Naip5 C A 13: 100,223,114 S538I probably benign Het
Nek3 A T 8: 22,158,612 probably benign Het
Nlrp1b A G 11: 71,161,759 S948P probably damaging Het
Olfr1413 A G 1: 92,573,461 K97E possibly damaging Het
Olfr648 T A 7: 104,179,473 K312* probably null Het
Patl2 G A 2: 122,125,710 probably benign Het
Pcdhb11 A T 18: 37,423,989 R791W probably benign Het
Pkd1l3 C A 8: 109,628,633 probably benign Het
Pkn2 A T 3: 142,828,988 V73D probably benign Het
Pknox1 A T 17: 31,599,636 H281L probably damaging Het
Polr3a A G 14: 24,452,189 probably benign Het
Prss38 A G 11: 59,373,180 probably benign Het
Rad54l2 A G 9: 106,708,217 F783S probably damaging Het
Rbm5 T C 9: 107,742,424 R125G probably damaging Het
Rnpep A G 1: 135,272,485 probably benign Het
Slc1a5 T A 7: 16,793,637 probably null Het
Slc22a4 G A 11: 54,028,003 probably benign Het
Spink12 T C 18: 44,107,696 C50R probably damaging Het
Svep1 G A 4: 58,066,460 T3208I possibly damaging Het
Tgm5 G T 2: 121,077,646 D16E probably damaging Het
Tpp2 A G 1: 43,971,726 N558D probably benign Het
Trappc9 A T 15: 72,963,662 L507Q probably damaging Het
Trpm3 A T 19: 22,715,331 Q262L possibly damaging Het
Ttn A G 2: 76,776,972 probably benign Het
Ttn G A 2: 76,832,089 probably benign Het
Ubr4 T A 4: 139,451,788 L3316Q probably damaging Het
Uckl1 T A 2: 181,574,655 Y136F probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps39 A G 2: 120,318,053 V870A probably benign Het
Zdhhc25 A G 15: 88,600,909 D149G probably benign Het
Zfp648 C T 1: 154,205,286 T397M probably damaging Het
Zic2 C A 14: 122,478,957 T435K probably damaging Het
Other mutations in Nyap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Nyap2 APN 1 81191980 missense probably damaging 0.99
IGL01660:Nyap2 APN 1 81191927 missense probably damaging 0.99
IGL02379:Nyap2 APN 1 81087430 missense probably damaging 1.00
IGL02652:Nyap2 APN 1 81241720 missense probably damaging 1.00
IGL03217:Nyap2 APN 1 81087322 missense probably damaging 1.00
IGL03410:Nyap2 APN 1 81241441 missense possibly damaging 0.95
R0014:Nyap2 UTSW 1 81241951 missense probably damaging 0.99
R0506:Nyap2 UTSW 1 81087312 missense probably damaging 0.99
R1512:Nyap2 UTSW 1 81241851 missense probably damaging 0.98
R1914:Nyap2 UTSW 1 81191887 missense probably damaging 1.00
R2018:Nyap2 UTSW 1 81191872 missense probably benign 0.03
R2078:Nyap2 UTSW 1 81191981 missense probably damaging 1.00
R2139:Nyap2 UTSW 1 81241268 missense probably damaging 1.00
R2915:Nyap2 UTSW 1 81087471 nonsense probably null
R2972:Nyap2 UTSW 1 81191770 nonsense probably null
R2974:Nyap2 UTSW 1 81191770 nonsense probably null
R3076:Nyap2 UTSW 1 81241971 critical splice donor site probably null
R4066:Nyap2 UTSW 1 81241835 missense probably damaging 1.00
R4134:Nyap2 UTSW 1 81241193 missense probably damaging 0.99
R4298:Nyap2 UTSW 1 81241096 missense probably damaging 1.00
R4652:Nyap2 UTSW 1 81336729 missense probably damaging 0.98
R4788:Nyap2 UTSW 1 81269397 missense probably benign
R4816:Nyap2 UTSW 1 81241313 missense probably damaging 1.00
R5211:Nyap2 UTSW 1 81087274 start codon destroyed probably null 0.77
R5327:Nyap2 UTSW 1 81192041 missense possibly damaging 0.77
R5453:Nyap2 UTSW 1 81192142 missense probably benign 0.01
R7337:Nyap2 UTSW 1 81336515 missense possibly damaging 0.50
R7558:Nyap2 UTSW 1 81269373 missense probably benign 0.01
X0067:Nyap2 UTSW 1 81269319 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTCATGACGATGCCTGCACCTC -3'
(R):5'- TCCTGCAAGCATTCTGCTGCTG -3'

Sequencing Primer
(F):5'- TGTGGATCACGAAGACAACC -3'
(R):5'- AAGCATTCTGCTGCTGTACTATATC -3'
Posted On2013-05-09