Incidental Mutation 'R4288:E130308A19Rik'
ID322096
Institutional Source Beutler Lab
Gene Symbol E130308A19Rik
Ensembl Gene ENSMUSG00000045071
Gene NameRIKEN cDNA E130308A19 gene
Synonyms
MMRRC Submission 041653-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R4288 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location59626211-59761439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59690308 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 47 (M47I)
Ref Sequence ENSEMBL: ENSMUSP00000065702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052420] [ENSMUST00000070150]
Predicted Effect probably benign
Transcript: ENSMUST00000052420
AA Change: M47I

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000062493
Gene: ENSMUSG00000045071
AA Change: M47I

DomainStartEndE-ValueType
low complexity region 130 141 N/A INTRINSIC
low complexity region 364 387 N/A INTRINSIC
Pfam:DUF3504 520 673 2.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070150
AA Change: M47I

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065702
Gene: ENSMUSG00000045071
AA Change: M47I

DomainStartEndE-ValueType
low complexity region 130 141 N/A INTRINSIC
low complexity region 364 387 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
Pfam:DUF3504 532 687 4.5e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152797
Meta Mutation Damage Score 0.0800 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (34/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd G A 1: 127,738,572 V27M probably damaging Het
Acsl6 A G 11: 54,337,086 T311A probably benign Het
Adss G A 1: 177,776,512 R176W probably damaging Het
Akr7a5 T C 4: 139,314,104 V108A probably benign Het
Atp13a1 A G 8: 69,794,078 D209G possibly damaging Het
Cdcp1 T A 9: 123,183,628 I285F probably damaging Het
Ctnna2 C T 6: 77,605,221 R339Q probably damaging Het
D3Ertd254e A G 3: 36,159,598 N27S possibly damaging Het
Exosc9 C T 3: 36,563,216 T373I probably benign Het
Fam71e2 T A 7: 4,770,723 N58Y possibly damaging Het
Fat4 T A 3: 38,891,763 S1602T probably damaging Het
Fbn2 T C 18: 58,035,339 I2309V probably damaging Het
Fbxo42 T C 4: 141,167,896 Y57H probably damaging Het
Fcrl5 A G 3: 87,442,224 D102G probably benign Het
Gpr37l1 A G 1: 135,161,184 V381A probably damaging Het
Hc G T 2: 35,030,402 A644E probably damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Impad1 A C 4: 4,778,231 V169G probably damaging Het
Lpar5 T C 6: 125,081,864 Y183H probably benign Het
Ltn1 T A 16: 87,397,988 N1341I possibly damaging Het
Mms19 A G 19: 41,945,553 L938P probably damaging Het
Neb T G 2: 52,259,300 E2516D probably damaging Het
Parp4 T C 14: 56,607,494 V614A probably damaging Het
Pogk A G 1: 166,403,506 L84P probably damaging Het
Stard13 G A 5: 151,045,177 T994M probably damaging Het
Stk4 A G 2: 164,099,712 S283G probably benign Het
Ttn T C 2: 76,810,398 T13669A probably benign Het
Vil1 A G 1: 74,418,525 T106A probably benign Het
Vmn1r18 A G 6: 57,390,407 L54P probably damaging Het
Vmn1r227 G T 17: 20,735,830 noncoding transcript Het
Zfp748 T A 13: 67,541,083 H686L probably damaging Het
Zyg11a C T 4: 108,184,469 S658N probably damaging Het
Other mutations in E130308A19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:E130308A19Rik APN 4 59737743 splice site probably benign
IGL00672:E130308A19Rik APN 4 59719697 missense probably benign 0.00
IGL00937:E130308A19Rik APN 4 59690846 missense probably benign 0.01
IGL01885:E130308A19Rik APN 4 59720004 missense probably benign 0.20
IGL02638:E130308A19Rik APN 4 59719676 nonsense probably null
H8562:E130308A19Rik UTSW 4 59691033 missense possibly damaging 0.70
R0044:E130308A19Rik UTSW 4 59690290 missense possibly damaging 0.86
R0523:E130308A19Rik UTSW 4 59719716 missense probably damaging 0.98
R0788:E130308A19Rik UTSW 4 59719847 missense possibly damaging 0.76
R1215:E130308A19Rik UTSW 4 59690743 missense probably benign 0.37
R1490:E130308A19Rik UTSW 4 59719746 missense probably damaging 0.99
R2292:E130308A19Rik UTSW 4 59690579 missense probably damaging 0.99
R3907:E130308A19Rik UTSW 4 59752393 missense probably benign 0.14
R4780:E130308A19Rik UTSW 4 59691057 missense probably benign 0.01
R4781:E130308A19Rik UTSW 4 59691057 missense probably benign 0.01
R4834:E130308A19Rik UTSW 4 59690317 nonsense probably null
R4985:E130308A19Rik UTSW 4 59691017 missense probably benign 0.01
R6123:E130308A19Rik UTSW 4 59737565 missense probably damaging 1.00
R6290:E130308A19Rik UTSW 4 59691332 missense probably benign 0.25
R6315:E130308A19Rik UTSW 4 59691132 missense probably benign
R6643:E130308A19Rik UTSW 4 59720561 missense possibly damaging 0.90
R6763:E130308A19Rik UTSW 4 59752288 missense probably damaging 0.99
R6980:E130308A19Rik UTSW 4 59719991 missense probably damaging 0.97
R7036:E130308A19Rik UTSW 4 59719991 missense probably damaging 0.97
R7078:E130308A19Rik UTSW 4 59737688 missense probably damaging 1.00
R7098:E130308A19Rik UTSW 4 59753004 missense possibly damaging 0.88
R7171:E130308A19Rik UTSW 4 59690333 missense probably damaging 1.00
R7247:E130308A19Rik UTSW 4 59690502 missense probably damaging 1.00
R7366:E130308A19Rik UTSW 4 59752770 missense probably damaging 0.99
R7916:E130308A19Rik UTSW 4 59719841 missense probably damaging 1.00
R8050:E130308A19Rik UTSW 4 59719767 missense probably damaging 1.00
R8445:E130308A19Rik UTSW 4 59720526 missense probably damaging 0.99
Z1176:E130308A19Rik UTSW 4 59720313 missense probably damaging 1.00
Z1177:E130308A19Rik UTSW 4 59720223 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGAATGTCTTGGGTAATAACAG -3'
(R):5'- CAGCTTTGCCTTCACAGGTC -3'

Sequencing Primer
(F):5'- ATGTCTTGGGTAATAACAGTTTCTTG -3'
(R):5'- TTCACAGGTCTCCCAGGGTAC -3'
Posted On2015-06-20