Incidental Mutation 'R0001:Olfr1413'
ID32210
Institutional Source Beutler Lab
Gene Symbol Olfr1413
Ensembl Gene ENSMUSG00000058904
Gene Nameolfactory receptor 1413
SynonymsGA_x6K02T2R7CC-81180849-81179878, MOR208-1
MMRRC Submission 038297-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0001 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location92571322-92574397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92573461 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 97 (K97E)
Ref Sequence ENSEMBL: ENSMUSP00000150792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074859] [ENSMUST00000214239]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074859
AA Change: K97E

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074402
Gene: ENSMUSG00000058904
AA Change: K97E

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
Pfam:7tm_4 38 314 2.3e-50 PFAM
Pfam:7tm_1 48 297 2.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185802
Predicted Effect possibly damaging
Transcript: ENSMUST00000214239
AA Change: K97E

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik G A 19: 58,789,171 A61V probably damaging Het
2900092C05Rik T A 7: 12,554,607 probably benign Het
A4galt A G 15: 83,228,289 F98L probably benign Het
Abca4 T G 3: 122,081,011 probably benign Het
Acacb C T 5: 114,204,833 probably benign Het
Agbl1 A T 7: 76,419,863 H367L probably damaging Het
Apoa4 C A 9: 46,242,892 Q264K probably benign Het
Camsap2 A T 1: 136,282,888 probably benign Het
Cdan1 C A 2: 120,723,751 R939L probably benign Het
Ceacam18 G A 7: 43,636,876 V58I possibly damaging Het
Ciita A T 16: 10,514,433 probably benign Het
Clk4 T A 11: 51,268,765 probably benign Het
Cntnap2 T C 6: 46,530,171 D215G probably benign Het
Col11a2 T C 17: 34,061,612 S1218P probably benign Het
Col20a1 T C 2: 180,984,412 probably benign Het
Ctsb A G 14: 63,135,622 E76G probably benign Het
Ctu2 T C 8: 122,478,920 C161R probably benign Het
Dhx29 T C 13: 112,964,556 L1211P probably damaging Het
Dhx9 G T 1: 153,462,636 T759K probably damaging Het
Dmxl1 T C 18: 49,888,897 probably benign Het
Dpysl3 C T 18: 43,358,375 E226K possibly damaging Het
Eif2d A T 1: 131,168,127 K453* probably null Het
Epha7 T C 4: 28,961,279 probably benign Het
Fam160b1 T A 19: 57,381,756 H477Q probably benign Het
Fat3 T C 9: 16,377,873 D118G probably damaging Het
Foxn4 T A 5: 114,260,870 Q159L probably damaging Het
Frs2 G T 10: 117,074,876 H194N possibly damaging Het
Fut8 A T 12: 77,475,315 *576L probably null Het
Galns T C 8: 122,595,883 probably benign Het
Gamt G A 10: 80,259,061 probably benign Het
Gpn1 T A 5: 31,495,617 probably benign Het
Ipcef1 G T 10: 6,900,600 H330Q probably damaging Het
Itga4 A C 2: 79,326,587 Y1024S probably damaging Het
Jak2 A G 19: 29,282,387 I229V probably benign Het
Katnal1 A G 5: 148,921,275 S42P probably damaging Het
Kcnu1 A T 8: 25,859,270 D142V probably damaging Het
Lig3 C T 11: 82,790,591 R470W probably damaging Het
Mgat4c A G 10: 102,388,956 S344G probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mipol1 C T 12: 57,460,839 probably benign Het
Mki67 C T 7: 135,699,172 V1378M probably damaging Het
Mki67 T A 7: 135,701,019 D762V probably damaging Het
Mmp9 A G 2: 164,948,383 T43A probably benign Het
Muc6 T C 7: 141,641,574 T1316A possibly damaging Het
Naip5 A G 13: 100,214,650 probably null Het
Naip5 C A 13: 100,223,114 S538I probably benign Het
Nek3 A T 8: 22,158,612 probably benign Het
Nlrp1b A G 11: 71,161,759 S948P probably damaging Het
Nyap2 A T 1: 81,192,107 H193L probably benign Het
Olfr648 T A 7: 104,179,473 K312* probably null Het
Patl2 G A 2: 122,125,710 probably benign Het
Pcdhb11 A T 18: 37,423,989 R791W probably benign Het
Pkd1l3 C A 8: 109,628,633 probably benign Het
Pkn2 A T 3: 142,828,988 V73D probably benign Het
Pknox1 A T 17: 31,599,636 H281L probably damaging Het
Polr3a A G 14: 24,452,189 probably benign Het
Prss38 A G 11: 59,373,180 probably benign Het
Rad54l2 A G 9: 106,708,217 F783S probably damaging Het
Rbm5 T C 9: 107,742,424 R125G probably damaging Het
Rnpep A G 1: 135,272,485 probably benign Het
Slc1a5 T A 7: 16,793,637 probably null Het
Slc22a4 G A 11: 54,028,003 probably benign Het
Spink12 T C 18: 44,107,696 C50R probably damaging Het
Svep1 G A 4: 58,066,460 T3208I possibly damaging Het
Tgm5 G T 2: 121,077,646 D16E probably damaging Het
Tpp2 A G 1: 43,971,726 N558D probably benign Het
Trappc9 A T 15: 72,963,662 L507Q probably damaging Het
Trpm3 A T 19: 22,715,331 Q262L possibly damaging Het
Ttn A G 2: 76,776,972 probably benign Het
Ttn G A 2: 76,832,089 probably benign Het
Ubr4 T A 4: 139,451,788 L3316Q probably damaging Het
Uckl1 T A 2: 181,574,655 Y136F probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps39 A G 2: 120,318,053 V870A probably benign Het
Zdhhc25 A G 15: 88,600,909 D149G probably benign Het
Zfp648 C T 1: 154,205,286 T397M probably damaging Het
Zic2 C A 14: 122,478,957 T435K probably damaging Het
Other mutations in Olfr1413
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Olfr1413 APN 1 92573443 missense probably benign 0.01
IGL01829:Olfr1413 APN 1 92573329 missense probably benign 0.37
IGL02160:Olfr1413 APN 1 92573357 missense probably damaging 1.00
IGL02535:Olfr1413 APN 1 92573221 missense probably benign 0.10
IGL03304:Olfr1413 APN 1 92573303 missense probably benign 0.01
R0033:Olfr1413 UTSW 1 92573260 missense probably benign 0.05
R2027:Olfr1413 UTSW 1 92573767 missense probably damaging 0.99
R2152:Olfr1413 UTSW 1 92573908 missense probably damaging 1.00
R2174:Olfr1413 UTSW 1 92573657 missense probably benign 0.00
R3407:Olfr1413 UTSW 1 92573953 missense probably damaging 0.99
R3408:Olfr1413 UTSW 1 92573953 missense probably damaging 0.99
R3951:Olfr1413 UTSW 1 92573789 missense possibly damaging 0.53
R4687:Olfr1413 UTSW 1 92573330 missense possibly damaging 0.63
R4793:Olfr1413 UTSW 1 92573485 missense possibly damaging 0.89
R5069:Olfr1413 UTSW 1 92573413 missense probably damaging 1.00
R5070:Olfr1413 UTSW 1 92573413 missense probably damaging 1.00
R5160:Olfr1413 UTSW 1 92573822 missense probably benign 0.02
R5411:Olfr1413 UTSW 1 92573824 missense probably benign 0.00
R7487:Olfr1413 UTSW 1 92573795 missense possibly damaging 0.49
R7677:Olfr1413 UTSW 1 92573261 missense not run
R7832:Olfr1413 UTSW 1 92573497 missense probably benign 0.03
R7860:Olfr1413 UTSW 1 92574088 missense probably benign 0.11
R7984:Olfr1413 UTSW 1 92573422 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CACAGAAATGGAAGCCTCTCAGCAG -3'
(R):5'- ACAATGGAGTTCAGGCAGCCAC -3'

Sequencing Primer
(F):5'- AAGCCTCTCAGCAGTGTCC -3'
(R):5'- CACAGTATGTGCCCAGGAC -3'
Posted On2013-05-09