Incidental Mutation 'R4288:Lpar5'
ID322104
Institutional Source Beutler Lab
Gene Symbol Lpar5
Ensembl Gene ENSMUSG00000067714
Gene Namelysophosphatidic acid receptor 5
SynonymsLPA5, LOC381810, Gpr92, GPR93
MMRRC Submission 041653-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R4288 (G1)
Quality Score217
Status Validated
Chromosome6
Chromosomal Location125067920-125082472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125081864 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 183 (Y183H)
Ref Sequence ENSEMBL: ENSMUSP00000132511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088292] [ENSMUST00000140346] [ENSMUST00000171989]
Predicted Effect probably benign
Transcript: ENSMUST00000088292
AA Change: Y183H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000085630
Gene: ENSMUSG00000067714
AA Change: Y183H

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:7tm_1 55 313 7.4e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140346
SMART Domains Protein: ENSMUSP00000119904
Gene: ENSMUSG00000067714

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:7tm_1 55 164 1.5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171989
AA Change: Y183H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000132511
Gene: ENSMUSG00000067714
AA Change: Y183H

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:7tm_1 55 313 1.1e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203956
Meta Mutation Damage Score 0.1179 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the rhodopsin class of G protein-coupled transmembrane receptors. This protein transmits extracellular signals from lysophosphatidic acid to cells through heterotrimeric G proteins and mediates numerous cellular processes. Many G protein receptors serve as targets for pharmaceutical drugs. Transcript variants of this gene have been described.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to neuropathic pain and myelin sheath alterations. Mice homozygous for a different targeted allele exhibit decreased nociception sensitivity, decreased anxiety-related response and enhanced coordination and spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd G A 1: 127,738,572 V27M probably damaging Het
Acsl6 A G 11: 54,337,086 T311A probably benign Het
Adss G A 1: 177,776,512 R176W probably damaging Het
Akr7a5 T C 4: 139,314,104 V108A probably benign Het
Atp13a1 A G 8: 69,794,078 D209G possibly damaging Het
Cdcp1 T A 9: 123,183,628 I285F probably damaging Het
Ctnna2 C T 6: 77,605,221 R339Q probably damaging Het
D3Ertd254e A G 3: 36,159,598 N27S possibly damaging Het
E130308A19Rik G A 4: 59,690,308 M47I probably benign Het
Exosc9 C T 3: 36,563,216 T373I probably benign Het
Fam71e2 T A 7: 4,770,723 N58Y possibly damaging Het
Fat4 T A 3: 38,891,763 S1602T probably damaging Het
Fbn2 T C 18: 58,035,339 I2309V probably damaging Het
Fbxo42 T C 4: 141,167,896 Y57H probably damaging Het
Fcrl5 A G 3: 87,442,224 D102G probably benign Het
Gpr37l1 A G 1: 135,161,184 V381A probably damaging Het
Hc G T 2: 35,030,402 A644E probably damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Impad1 A C 4: 4,778,231 V169G probably damaging Het
Ltn1 T A 16: 87,397,988 N1341I possibly damaging Het
Mms19 A G 19: 41,945,553 L938P probably damaging Het
Neb T G 2: 52,259,300 E2516D probably damaging Het
Parp4 T C 14: 56,607,494 V614A probably damaging Het
Pogk A G 1: 166,403,506 L84P probably damaging Het
Stard13 G A 5: 151,045,177 T994M probably damaging Het
Stk4 A G 2: 164,099,712 S283G probably benign Het
Ttn T C 2: 76,810,398 T13669A probably benign Het
Vil1 A G 1: 74,418,525 T106A probably benign Het
Vmn1r18 A G 6: 57,390,407 L54P probably damaging Het
Vmn1r227 G T 17: 20,735,830 noncoding transcript Het
Zfp748 T A 13: 67,541,083 H686L probably damaging Het
Zyg11a C T 4: 108,184,469 S658N probably damaging Het
Other mutations in Lpar5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Lpar5 APN 6 125082006 missense possibly damaging 0.94
IGL01830:Lpar5 APN 6 125081822 missense probably benign 0.01
IGL01975:Lpar5 APN 6 125081787 missense probably damaging 0.99
IGL02021:Lpar5 APN 6 125081992 nonsense probably null
IGL02718:Lpar5 APN 6 125082244 missense probably damaging 1.00
IGL03027:Lpar5 APN 6 125082240 missense probably damaging 1.00
IGL03300:Lpar5 APN 6 125082240 missense probably damaging 1.00
F5770:Lpar5 UTSW 6 125081727 missense possibly damaging 0.88
R0633:Lpar5 UTSW 6 125081991 missense probably benign 0.25
R1639:Lpar5 UTSW 6 125081601 missense probably damaging 1.00
R1822:Lpar5 UTSW 6 125081415 missense possibly damaging 0.76
R2227:Lpar5 UTSW 6 125081135 critical splice acceptor site probably null
R4019:Lpar5 UTSW 6 125081675 missense probably damaging 1.00
R4705:Lpar5 UTSW 6 125082207 missense possibly damaging 0.64
R4787:Lpar5 UTSW 6 125082498 unclassified probably null
R5027:Lpar5 UTSW 6 125082147 missense possibly damaging 0.69
R6114:Lpar5 UTSW 6 125081676 missense probably damaging 1.00
R7197:Lpar5 UTSW 6 125082384 missense probably benign 0.00
R7779:Lpar5 UTSW 6 125082244 missense probably damaging 1.00
R8193:Lpar5 UTSW 6 125081339 missense probably benign
R8264:Lpar5 UTSW 6 125081502 missense probably damaging 1.00
V7580:Lpar5 UTSW 6 125081727 missense possibly damaging 0.88
V7581:Lpar5 UTSW 6 125081727 missense possibly damaging 0.88
V7582:Lpar5 UTSW 6 125081727 missense possibly damaging 0.88
Z1176:Lpar5 UTSW 6 125081379 missense possibly damaging 0.92
Z1176:Lpar5 UTSW 6 125082072 missense probably damaging 1.00
Z1177:Lpar5 UTSW 6 125082018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGCAGCTGTCTCTTTCTG -3'
(R):5'- TGATGAGATTGGCCAGCAG -3'

Sequencing Primer
(F):5'- TGATGCTCATCAACGTGGAC -3'
(R):5'- GGTCTTCCGTCGCCGTTG -3'
Posted On2015-06-20