Incidental Mutation 'R0001:Eif2d'
ID32211
Institutional Source Beutler Lab
Gene Symbol Eif2d
Ensembl Gene ENSMUSG00000026427
Gene Nameeukaryotic translation initiation factor 2D
SynonymsLgtn, D1Ertd5e
MMRRC Submission 038297-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0001 (G1)
Quality Score219
Status Validated
Chromosome1
Chromosomal Location131153181-131187658 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 131168127 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 453 (K453*)
Ref Sequence ENSEMBL: ENSMUSP00000138061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068791] [ENSMUST00000068805] [ENSMUST00000112446] [ENSMUST00000131855] [ENSMUST00000149119] [ENSMUST00000151874]
Predicted Effect probably null
Transcript: ENSMUST00000068791
AA Change: K403*
SMART Domains Protein: ENSMUSP00000067461
Gene: ENSMUSG00000026427
AA Change: K403*

DomainStartEndE-ValueType
PUA 99 173 1.07e-5 SMART
low complexity region 297 306 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000068805
AA Change: K453*
SMART Domains Protein: ENSMUSP00000063894
Gene: ENSMUSG00000026427
AA Change: K453*

DomainStartEndE-ValueType
PUA 99 173 1.07e-5 SMART
low complexity region 297 306 N/A INTRINSIC
Pfam:SUI1 474 554 1.1e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112446
AA Change: K453*
SMART Domains Protein: ENSMUSP00000108065
Gene: ENSMUSG00000026427
AA Change: K453*

DomainStartEndE-ValueType
PUA 99 173 1.07e-5 SMART
low complexity region 297 306 N/A INTRINSIC
Pfam:SUI1 472 551 3.5e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131855
AA Change: K453*
SMART Domains Protein: ENSMUSP00000137678
Gene: ENSMUSG00000026427
AA Change: K453*

DomainStartEndE-ValueType
PUA 99 173 1.07e-5 SMART
low complexity region 297 306 N/A INTRINSIC
Pfam:SUI1 472 554 8.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149119
SMART Domains Protein: ENSMUSP00000137887
Gene: ENSMUSG00000026427

DomainStartEndE-ValueType
PUA 99 173 1.07e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000151874
AA Change: K453*
SMART Domains Protein: ENSMUSP00000138061
Gene: ENSMUSG00000026427
AA Change: K453*

DomainStartEndE-ValueType
PUA 99 173 1.07e-5 SMART
low complexity region 297 306 N/A INTRINSIC
Pfam:SUI1 472 556 1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153651
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a translation initiation factor involved in the recruitment and delivery of aminoacyl-tRNAs to the P-site of the eukaryotic ribosome in a GTP-independent manner. This gene was previously referred to as ligatin, but is now known to localize to the cytoplasm and localize and function with translation factors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik G A 19: 58,789,171 A61V probably damaging Het
2900092C05Rik T A 7: 12,554,607 probably benign Het
A4galt A G 15: 83,228,289 F98L probably benign Het
Abca4 T G 3: 122,081,011 probably benign Het
Acacb C T 5: 114,204,833 probably benign Het
Agbl1 A T 7: 76,419,863 H367L probably damaging Het
Apoa4 C A 9: 46,242,892 Q264K probably benign Het
Camsap2 A T 1: 136,282,888 probably benign Het
Cdan1 C A 2: 120,723,751 R939L probably benign Het
Ceacam18 G A 7: 43,636,876 V58I possibly damaging Het
Ciita A T 16: 10,514,433 probably benign Het
Clk4 T A 11: 51,268,765 probably benign Het
Cntnap2 T C 6: 46,530,171 D215G probably benign Het
Col11a2 T C 17: 34,061,612 S1218P probably benign Het
Col20a1 T C 2: 180,984,412 probably benign Het
Ctsb A G 14: 63,135,622 E76G probably benign Het
Ctu2 T C 8: 122,478,920 C161R probably benign Het
Dhx29 T C 13: 112,964,556 L1211P probably damaging Het
Dhx9 G T 1: 153,462,636 T759K probably damaging Het
Dmxl1 T C 18: 49,888,897 probably benign Het
Dpysl3 C T 18: 43,358,375 E226K possibly damaging Het
Epha7 T C 4: 28,961,279 probably benign Het
Fam160b1 T A 19: 57,381,756 H477Q probably benign Het
Fat3 T C 9: 16,377,873 D118G probably damaging Het
Foxn4 T A 5: 114,260,870 Q159L probably damaging Het
Frs2 G T 10: 117,074,876 H194N possibly damaging Het
Fut8 A T 12: 77,475,315 *576L probably null Het
Galns T C 8: 122,595,883 probably benign Het
Gamt G A 10: 80,259,061 probably benign Het
Gpn1 T A 5: 31,495,617 probably benign Het
Ipcef1 G T 10: 6,900,600 H330Q probably damaging Het
Itga4 A C 2: 79,326,587 Y1024S probably damaging Het
Jak2 A G 19: 29,282,387 I229V probably benign Het
Katnal1 A G 5: 148,921,275 S42P probably damaging Het
Kcnu1 A T 8: 25,859,270 D142V probably damaging Het
Lig3 C T 11: 82,790,591 R470W probably damaging Het
Mgat4c A G 10: 102,388,956 S344G probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mipol1 C T 12: 57,460,839 probably benign Het
Mki67 C T 7: 135,699,172 V1378M probably damaging Het
Mki67 T A 7: 135,701,019 D762V probably damaging Het
Mmp9 A G 2: 164,948,383 T43A probably benign Het
Muc6 T C 7: 141,641,574 T1316A possibly damaging Het
Naip5 A G 13: 100,214,650 probably null Het
Naip5 C A 13: 100,223,114 S538I probably benign Het
Nek3 A T 8: 22,158,612 probably benign Het
Nlrp1b A G 11: 71,161,759 S948P probably damaging Het
Nyap2 A T 1: 81,192,107 H193L probably benign Het
Olfr1413 A G 1: 92,573,461 K97E possibly damaging Het
Olfr648 T A 7: 104,179,473 K312* probably null Het
Patl2 G A 2: 122,125,710 probably benign Het
Pcdhb11 A T 18: 37,423,989 R791W probably benign Het
Pkd1l3 C A 8: 109,628,633 probably benign Het
Pkn2 A T 3: 142,828,988 V73D probably benign Het
Pknox1 A T 17: 31,599,636 H281L probably damaging Het
Polr3a A G 14: 24,452,189 probably benign Het
Prss38 A G 11: 59,373,180 probably benign Het
Rad54l2 A G 9: 106,708,217 F783S probably damaging Het
Rbm5 T C 9: 107,742,424 R125G probably damaging Het
Rnpep A G 1: 135,272,485 probably benign Het
Slc1a5 T A 7: 16,793,637 probably null Het
Slc22a4 G A 11: 54,028,003 probably benign Het
Spink12 T C 18: 44,107,696 C50R probably damaging Het
Svep1 G A 4: 58,066,460 T3208I possibly damaging Het
Tgm5 G T 2: 121,077,646 D16E probably damaging Het
Tpp2 A G 1: 43,971,726 N558D probably benign Het
Trappc9 A T 15: 72,963,662 L507Q probably damaging Het
Trpm3 A T 19: 22,715,331 Q262L possibly damaging Het
Ttn A G 2: 76,776,972 probably benign Het
Ttn G A 2: 76,832,089 probably benign Het
Ubr4 T A 4: 139,451,788 L3316Q probably damaging Het
Uckl1 T A 2: 181,574,655 Y136F probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps39 A G 2: 120,318,053 V870A probably benign Het
Zdhhc25 A G 15: 88,600,909 D149G probably benign Het
Zfp648 C T 1: 154,205,286 T397M probably damaging Het
Zic2 C A 14: 122,478,957 T435K probably damaging Het
Other mutations in Eif2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Eif2d APN 1 131166352 missense probably benign 0.06
IGL00848:Eif2d APN 1 131164436 nonsense probably null
IGL02250:Eif2d APN 1 131160429 missense probably benign 0.34
IGL02423:Eif2d APN 1 131153360 utr 5 prime probably benign
IGL02877:Eif2d APN 1 131165117 splice site probably benign
R0593:Eif2d UTSW 1 131155728 splice site probably benign
R0739:Eif2d UTSW 1 131154363 missense probably damaging 1.00
R1842:Eif2d UTSW 1 131171060 missense probably damaging 1.00
R2088:Eif2d UTSW 1 131164727 missense probably damaging 0.98
R4206:Eif2d UTSW 1 131154363 missense probably damaging 1.00
R4732:Eif2d UTSW 1 131164727 missense probably damaging 0.98
R4733:Eif2d UTSW 1 131164727 missense probably damaging 0.98
R4734:Eif2d UTSW 1 131165152 missense probably damaging 1.00
R4931:Eif2d UTSW 1 131154391 missense probably damaging 1.00
R5281:Eif2d UTSW 1 131173343 missense probably damaging 1.00
R5419:Eif2d UTSW 1 131158298 makesense probably null
R5773:Eif2d UTSW 1 131158303 splice site probably null
R6074:Eif2d UTSW 1 131166342 missense probably damaging 1.00
R6947:Eif2d UTSW 1 131164667 missense probably benign 0.00
R7396:Eif2d UTSW 1 131166374 missense probably benign 0.13
R7419:Eif2d UTSW 1 131171056 missense probably benign 0.00
R7630:Eif2d UTSW 1 131154366 missense probably benign 0.01
R7910:Eif2d UTSW 1 131155213 missense probably damaging 1.00
R7991:Eif2d UTSW 1 131155213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTCACTGATGTTCCCGTCTCG -3'
(R):5'- CATGCTCTTCCAATGCAAAGCCTC -3'

Sequencing Primer
(F):5'- CTCTCTGAGGAGCTTTGAGACAC -3'
(R):5'- ggtggtggtaggggtgg -3'
Posted On2013-05-09