Incidental Mutation 'R4270:Xkr7'
ID322115
Institutional Source Beutler Lab
Gene Symbol Xkr7
Ensembl Gene ENSMUSG00000042631
Gene NameX-linked Kx blood group related 7
Synonyms
MMRRC Submission 041075-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R4270 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location153031852-153055775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 153054315 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 363 (V363A)
Ref Sequence ENSEMBL: ENSMUSP00000049346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037235]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037235
AA Change: V363A

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049346
Gene: ENSMUSG00000042631
AA Change: V363A

DomainStartEndE-ValueType
low complexity region 2 46 N/A INTRINSIC
low complexity region 92 107 N/A INTRINSIC
low complexity region 170 193 N/A INTRINSIC
IQ 196 218 1.28e1 SMART
low complexity region 260 274 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ash1l T A 3: 88,982,040 C409S probably benign Het
Aspg T C 12: 112,121,195 S327P probably damaging Het
Ccdc88c G T 12: 100,947,219 Q516K probably damaging Het
Cdh11 T A 8: 102,664,626 D326V possibly damaging Het
Ctsa G T 2: 164,835,302 M210I probably benign Het
Ctsh A G 9: 90,061,598 H92R probably damaging Het
Fanca A G 8: 123,268,794 L117P probably damaging Het
Foxo1 A G 3: 52,345,405 T330A probably benign Het
Gm10436 A T 12: 88,178,283 I91K probably damaging Het
Ighv1-43 C G 12: 114,946,152 G50A probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Kif26a C T 12: 112,173,414 S460F probably damaging Het
Mxra8 C A 4: 155,841,137 P98Q probably damaging Het
Nbr1 T C 11: 101,567,222 Y276H possibly damaging Het
Nckap1l T C 15: 103,473,122 L430P possibly damaging Het
Nubp2 A T 17: 24,885,593 C58S probably damaging Het
Olfr250 A G 9: 38,367,701 N52D probably damaging Het
Rbms3 T A 9: 117,056,748 N94I probably damaging Het
Rimbp2 T G 5: 128,819,777 N23T probably benign Het
Rwdd3 T C 3: 121,158,901 D147G probably damaging Het
Slc30a5 T G 13: 100,829,013 R29S probably benign Het
Syt10 C A 15: 89,790,892 R417L probably benign Het
Trim58 T C 11: 58,651,267 V351A probably damaging Het
Trpc3 G T 3: 36,662,925 Y321* probably null Het
Vmn2r107 G T 17: 20,355,779 V124F probably benign Het
Zfp597 A T 16: 3,872,090 M1K probably null Het
Other mutations in Xkr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02715:Xkr7 APN 2 153054357 missense probably damaging 0.99
R0125:Xkr7 UTSW 2 153032426 missense probably benign 0.01
R0531:Xkr7 UTSW 2 153032352 missense possibly damaging 0.65
R1121:Xkr7 UTSW 2 153054423 missense probably damaging 1.00
R2092:Xkr7 UTSW 2 153054063 missense probably damaging 0.98
R2132:Xkr7 UTSW 2 153052896 missense probably benign
R2264:Xkr7 UTSW 2 153054257 missense probably damaging 1.00
R2337:Xkr7 UTSW 2 153054398 missense possibly damaging 0.94
R2341:Xkr7 UTSW 2 153054398 missense possibly damaging 0.94
R4513:Xkr7 UTSW 2 153054633 missense probably benign 0.39
R4880:Xkr7 UTSW 2 153054953 missense probably damaging 1.00
R5022:Xkr7 UTSW 2 153054380 missense probably benign 0.00
R5023:Xkr7 UTSW 2 153054380 missense probably benign 0.00
R5057:Xkr7 UTSW 2 153054380 missense probably benign 0.00
R5198:Xkr7 UTSW 2 153054953 missense probably damaging 1.00
R5433:Xkr7 UTSW 2 153054324 missense probably damaging 1.00
R7385:Xkr7 UTSW 2 153054063 nonsense probably null
X0061:Xkr7 UTSW 2 153054183 missense probably benign 0.44
Z1177:Xkr7 UTSW 2 153054497 missense not run
Predicted Primers PCR Primer
(F):5'- CTCAAGAGATGACAAGCGGC -3'
(R):5'- CACATGAAGAATATGCCCAAGG -3'

Sequencing Primer
(F):5'- CTACAAGGGTGCTGTTGTCCAAG -3'
(R):5'- TGGAGGCTACCACGCAGAC -3'
Posted On2015-06-20