Incidental Mutation 'R4270:Cdh11'
ID322125
Institutional Source Beutler Lab
Gene Symbol Cdh11
Ensembl Gene ENSMUSG00000031673
Gene Namecadherin 11
Synonymsosteoblast-cadherin, Cad11, OB-cadherin
MMRRC Submission 041075-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4270 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location102632095-102785642 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102664626 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 326 (D326V)
Ref Sequence ENSEMBL: ENSMUSP00000074681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075190]
PDB Structure
Crystal structure of mouse cadherin-11 EC1 [X-RAY DIFFRACTION]
Crystal structure of mouse cadherin-11 EC1-2 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075190
AA Change: D326V

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074681
Gene: ENSMUSG00000031673
AA Change: D326V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 76 157 1.99e-19 SMART
CA 181 266 3.33e-30 SMART
CA 290 382 3.37e-17 SMART
CA 405 486 1.14e-23 SMART
CA 513 600 4.77e-8 SMART
transmembrane domain 618 640 N/A INTRINSIC
Pfam:Cadherin_C 643 788 1.1e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210425
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a type II classical cadherin and preproprotein that is proteolytically processed to generate a mature protein product. This protein product is an integral membrane protein that mediates calcium-dependent cell-cell adhesion, specifically in the context of bone development. Homozygous knockout mice for this gene exhibit impaired synovium development and reduced bone density. Multiple pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous mutant animals appear healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ash1l T A 3: 88,982,040 C409S probably benign Het
Aspg T C 12: 112,121,195 S327P probably damaging Het
Ccdc88c G T 12: 100,947,219 Q516K probably damaging Het
Ctsa G T 2: 164,835,302 M210I probably benign Het
Ctsh A G 9: 90,061,598 H92R probably damaging Het
Fanca A G 8: 123,268,794 L117P probably damaging Het
Foxo1 A G 3: 52,345,405 T330A probably benign Het
Gm10436 A T 12: 88,178,283 I91K probably damaging Het
Ighv1-43 C G 12: 114,946,152 G50A probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Kif26a C T 12: 112,173,414 S460F probably damaging Het
Mxra8 C A 4: 155,841,137 P98Q probably damaging Het
Nbr1 T C 11: 101,567,222 Y276H possibly damaging Het
Nckap1l T C 15: 103,473,122 L430P possibly damaging Het
Nubp2 A T 17: 24,885,593 C58S probably damaging Het
Olfr250 A G 9: 38,367,701 N52D probably damaging Het
Rbms3 T A 9: 117,056,748 N94I probably damaging Het
Rimbp2 T G 5: 128,819,777 N23T probably benign Het
Rwdd3 T C 3: 121,158,901 D147G probably damaging Het
Slc30a5 T G 13: 100,829,013 R29S probably benign Het
Syt10 C A 15: 89,790,892 R417L probably benign Het
Trim58 T C 11: 58,651,267 V351A probably damaging Het
Trpc3 G T 3: 36,662,925 Y321* probably null Het
Vmn2r107 G T 17: 20,355,779 V124F probably benign Het
Xkr7 T C 2: 153,054,315 V363A possibly damaging Het
Zfp597 A T 16: 3,872,090 M1K probably null Het
Other mutations in Cdh11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Cdh11 APN 8 102650649 missense probably damaging 1.00
IGL01019:Cdh11 APN 8 102679745 missense probably benign
IGL01286:Cdh11 APN 8 102664629 missense probably damaging 0.98
IGL01556:Cdh11 APN 8 102679644 missense probably damaging 1.00
IGL01964:Cdh11 APN 8 102664743 missense probably benign 0.03
IGL02322:Cdh11 APN 8 102647519 missense probably benign 0.01
IGL03094:Cdh11 APN 8 102658403 missense probably benign
IGL03110:Cdh11 APN 8 102673870 missense probably damaging 1.00
IGL03391:Cdh11 APN 8 102674023 missense possibly damaging 0.89
R0401:Cdh11 UTSW 8 102674006 missense probably damaging 1.00
R0466:Cdh11 UTSW 8 102670058 missense possibly damaging 0.89
R0731:Cdh11 UTSW 8 102668019 missense probably damaging 1.00
R0925:Cdh11 UTSW 8 102634724 missense probably damaging 1.00
R1597:Cdh11 UTSW 8 102650711 missense probably benign 0.06
R1624:Cdh11 UTSW 8 102664601 splice site probably benign
R1829:Cdh11 UTSW 8 102634641 missense possibly damaging 0.92
R2029:Cdh11 UTSW 8 102679772 missense probably benign 0.00
R4191:Cdh11 UTSW 8 102650748 missense probably damaging 0.98
R4271:Cdh11 UTSW 8 102664626 missense possibly damaging 0.69
R4455:Cdh11 UTSW 8 102647823 missense probably benign
R4516:Cdh11 UTSW 8 102673962 missense possibly damaging 0.59
R4900:Cdh11 UTSW 8 102647458 splice site probably null
R5441:Cdh11 UTSW 8 102647546 missense probably benign 0.11
R5699:Cdh11 UTSW 8 102634543 missense probably damaging 0.96
R6170:Cdh11 UTSW 8 102634810 missense probably benign 0.00
R6846:Cdh11 UTSW 8 102664644 missense probably damaging 0.97
R7018:Cdh11 UTSW 8 102634321 missense possibly damaging 0.82
R7095:Cdh11 UTSW 8 102658267 missense probably damaging 1.00
R7497:Cdh11 UTSW 8 102673824 missense probably benign 0.00
R7632:Cdh11 UTSW 8 102673883 missense probably damaging 0.99
R7715:Cdh11 UTSW 8 102664714 missense possibly damaging 0.66
R8321:Cdh11 UTSW 8 102634784 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TATCCTCAGAGTTCAAGCCTTAGC -3'
(R):5'- TCTGAAGTCTTACAGCTGCC -3'

Sequencing Primer
(F):5'- GAGTTCAAGCCTTAGCCACAAATTG -3'
(R):5'- GTCTTACAGCTGCCAAATAAAAAGG -3'
Posted On2015-06-20