Incidental Mutation 'R4270:Trim58'
ID322131
Institutional Source Beutler Lab
Gene Symbol Trim58
Ensembl Gene ENSMUSG00000037124
Gene Nametripartite motif-containing 58
SynonymsLOC386443, LOC216781
MMRRC Submission 041075-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R4270 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58640465-58652404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58651267 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 351 (V351A)
Ref Sequence ENSEMBL: ENSMUSP00000074594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075084]
Predicted Effect probably damaging
Transcript: ENSMUST00000075084
AA Change: V351A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074594
Gene: ENSMUSG00000037124
AA Change: V351A

DomainStartEndE-ValueType
RING 15 58 2.95e-7 SMART
BBOX 90 131 2.93e-11 SMART
coiled coil region 192 241 N/A INTRINSIC
PRY 289 341 5.33e-23 SMART
SPRY 342 461 6.16e-29 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ash1l T A 3: 88,982,040 C409S probably benign Het
Aspg T C 12: 112,121,195 S327P probably damaging Het
Ccdc88c G T 12: 100,947,219 Q516K probably damaging Het
Cdh11 T A 8: 102,664,626 D326V possibly damaging Het
Ctsa G T 2: 164,835,302 M210I probably benign Het
Ctsh A G 9: 90,061,598 H92R probably damaging Het
Fanca A G 8: 123,268,794 L117P probably damaging Het
Foxo1 A G 3: 52,345,405 T330A probably benign Het
Gm10436 A T 12: 88,178,283 I91K probably damaging Het
Ighv1-43 C G 12: 114,946,152 G50A probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Kif26a C T 12: 112,173,414 S460F probably damaging Het
Mxra8 C A 4: 155,841,137 P98Q probably damaging Het
Nbr1 T C 11: 101,567,222 Y276H possibly damaging Het
Nckap1l T C 15: 103,473,122 L430P possibly damaging Het
Nubp2 A T 17: 24,885,593 C58S probably damaging Het
Olfr250 A G 9: 38,367,701 N52D probably damaging Het
Rbms3 T A 9: 117,056,748 N94I probably damaging Het
Rimbp2 T G 5: 128,819,777 N23T probably benign Het
Rwdd3 T C 3: 121,158,901 D147G probably damaging Het
Slc30a5 T G 13: 100,829,013 R29S probably benign Het
Syt10 C A 15: 89,790,892 R417L probably benign Het
Trpc3 G T 3: 36,662,925 Y321* probably null Het
Vmn2r107 G T 17: 20,355,779 V124F probably benign Het
Xkr7 T C 2: 153,054,315 V363A possibly damaging Het
Zfp597 A T 16: 3,872,090 M1K probably null Het
Other mutations in Trim58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02351:Trim58 APN 11 58651350 missense probably damaging 1.00
IGL02358:Trim58 APN 11 58651350 missense probably damaging 1.00
IGL02792:Trim58 APN 11 58640466 utr 5 prime probably benign
IGL02794:Trim58 APN 11 58640466 utr 5 prime probably benign
IGL02875:Trim58 APN 11 58640466 utr 5 prime probably benign
IGL02934:Trim58 APN 11 58640466 utr 5 prime probably benign
IGL03083:Trim58 APN 11 58651390 missense probably benign 0.01
IGL03213:Trim58 APN 11 58651167 missense probably benign 0.00
R0011:Trim58 UTSW 11 58643120 missense probably benign 0.02
R0011:Trim58 UTSW 11 58643120 missense probably benign 0.02
R0735:Trim58 UTSW 11 58651393 missense probably benign 0.16
R1294:Trim58 UTSW 11 58643127 missense probably benign 0.28
R1929:Trim58 UTSW 11 58640667 missense possibly damaging 0.84
R2104:Trim58 UTSW 11 58643138 splice site probably benign
R2311:Trim58 UTSW 11 58643108 missense probably benign 0.02
R2981:Trim58 UTSW 11 58651561 missense probably damaging 1.00
R3432:Trim58 UTSW 11 58646961 splice site probably benign
R4450:Trim58 UTSW 11 58651365 missense probably benign 0.03
R4841:Trim58 UTSW 11 58651324 missense probably damaging 0.96
R4842:Trim58 UTSW 11 58651324 missense probably damaging 0.96
R5262:Trim58 UTSW 11 58651668 missense possibly damaging 0.88
R5979:Trim58 UTSW 11 58646083 missense probably damaging 1.00
R6101:Trim58 UTSW 11 58651615 missense probably benign 0.01
R6684:Trim58 UTSW 11 58651620 missense probably benign 0.00
R6747:Trim58 UTSW 11 58651264 missense probably benign 0.02
R7126:Trim58 UTSW 11 58640579 missense probably damaging 1.00
X0026:Trim58 UTSW 11 58645969 missense probably damaging 1.00
X0067:Trim58 UTSW 11 58647105 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGTCGACGTGAAGCTGGATC -3'
(R):5'- GGAGATTTCACCAGCTTCGTAGTC -3'

Sequencing Primer
(F):5'- ATCCGGCCACTGCTCAC -3'
(R):5'- TTCGTAGTCCAAAAAGATCCCGATG -3'
Posted On2015-06-20