Mutagenetix > Incidental Mutation

Incidental Mutation 'R4270:Vmn2r107'

322142

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r107

Ensembl Gene

ENSMUSG00000056910

Gene Name

vomeronasal 2, receptor 107

Synonyms

V2r6

MMRRC Submission

041075-MU

Accession Numbers

Genbank: NM_001104569; MGI: 1316664

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R4270 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20345425-20375772 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 20355779 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 124 (V124F)

Ref Sequence

ENSEMBL: ENSMUSP00000048706 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042090]

AlphaFold

E9PZJ7

Predicted Effect

probably benign
Transcript: ENSMUST00000042090
AA Change: V124F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000048706
Gene: ENSMUSG00000056910
AA Change: V124F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	83	466	3.6e-40	PFAM
Pfam:NCD3G	509	562	5.1e-21	PFAM
Pfam:7tm_3	593	830	8e-51	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ash1l	T	A	3: 88,982,040	C409S	probably benign	Het
Aspg	T	C	12: 112,121,195	S327P	probably damaging	Het
Ccdc88c	G	T	12: 100,947,219	Q516K	probably damaging	Het
Cdh11	T	A	8: 102,664,626	D326V	possibly damaging	Het
Ctsa	G	T	2: 164,835,302	M210I	probably benign	Het
Ctsh	A	G	9: 90,061,598	H92R	probably damaging	Het
Fanca	A	G	8: 123,268,794	L117P	probably damaging	Het
Foxo1	A	G	3: 52,345,405	T330A	probably benign	Het
Gm10436	A	T	12: 88,178,283	I91K	probably damaging	Het
Ighv1-43	C	G	12: 114,946,152	G50A	probably benign	Het
Igkv9-120	G	T	6: 68,050,367	R88S	possibly damaging	Het
Kif26a	C	T	12: 112,173,414	S460F	probably damaging	Het
Mxra8	C	A	4: 155,841,137	P98Q	probably damaging	Het
Nbr1	T	C	11: 101,567,222	Y276H	possibly damaging	Het
Nckap1l	T	C	15: 103,473,122	L430P	possibly damaging	Het
Nubp2	A	T	17: 24,885,593	C58S	probably damaging	Het
Olfr250	A	G	9: 38,367,701	N52D	probably damaging	Het
Rbms3	T	A	9: 117,056,748	N94I	probably damaging	Het
Rimbp2	T	G	5: 128,819,777	N23T	probably benign	Het
Rwdd3	T	C	3: 121,158,901	D147G	probably damaging	Het
Slc30a5	T	G	13: 100,829,013	R29S	probably benign	Het
Syt10	C	A	15: 89,790,892	R417L	probably benign	Het
Trim58	T	C	11: 58,651,267	V351A	probably damaging	Het
Trpc3	G	T	3: 36,662,925	Y321*	probably null	Het
Xkr7	T	C	2: 153,054,315	V363A	possibly damaging	Het
Zfp597	A	T	16: 3,872,090	M1K	probably null	Het

Other mutations in Vmn2r107

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Vmn2r107	APN	17	20375747	missense	probably damaging	0.98
IGL01768:Vmn2r107	APN	17	20345606	missense	probably benign	0.32
IGL02086:Vmn2r107	APN	17	20357800	missense	probably benign	0.00
IGL02136:Vmn2r107	APN	17	20374906	missense	probably benign	0.02
IGL02266:Vmn2r107	APN	17	20356777	missense	probably damaging	1.00
IGL02285:Vmn2r107	APN	17	20375561	missense	probably damaging	1.00
IGL02724:Vmn2r107	APN	17	20356744	missense	possibly damaging	0.49
IGL02998:Vmn2r107	APN	17	20357755	missense	probably damaging	0.99
IGL03089:Vmn2r107	APN	17	20375712	missense	probably benign	0.05
IGL03284:Vmn2r107	APN	17	20356911	missense	probably benign	0.07
IGL03307:Vmn2r107	APN	17	20356776	missense	probably benign	0.09
IGL03399:Vmn2r107	APN	17	20357958	splice site	probably benign
3-1:Vmn2r107	UTSW	17	20345504	missense	probably benign
BB006:Vmn2r107	UTSW	17	20345444	missense	probably null	0.96
BB016:Vmn2r107	UTSW	17	20345444	missense	probably null	0.96
R0285:Vmn2r107	UTSW	17	20345611	missense	probably benign	0.00
R0455:Vmn2r107	UTSW	17	20374823	splice site	probably benign
R0497:Vmn2r107	UTSW	17	20375132	missense	probably damaging	1.00
R0506:Vmn2r107	UTSW	17	20357759	missense	probably benign
R0621:Vmn2r107	UTSW	17	20374990	missense	probably benign	0.01
R0667:Vmn2r107	UTSW	17	20355654	missense	possibly damaging	0.91
R1118:Vmn2r107	UTSW	17	20356598	missense	probably benign	0.03
R1204:Vmn2r107	UTSW	17	20357769	missense	probably benign
R1237:Vmn2r107	UTSW	17	20356685	nonsense	probably null
R1485:Vmn2r107	UTSW	17	20374847	missense	possibly damaging	0.95
R1783:Vmn2r107	UTSW	17	20356513	missense	possibly damaging	0.51
R1873:Vmn2r107	UTSW	17	20345578	missense	probably benign	0.10
R1974:Vmn2r107	UTSW	17	20355617	splice site	probably null
R2009:Vmn2r107	UTSW	17	20375467	missense	probably benign	0.01
R2029:Vmn2r107	UTSW	17	20375287	missense	probably benign	0.01
R2164:Vmn2r107	UTSW	17	20375642	missense	probably damaging	1.00
R2269:Vmn2r107	UTSW	17	20375555	missense	possibly damaging	0.58
R3087:Vmn2r107	UTSW	17	20360345	missense	probably benign	0.03
R3740:Vmn2r107	UTSW	17	20374889	missense	probably benign	0.00
R3961:Vmn2r107	UTSW	17	20375455	missense	probably damaging	1.00
R4031:Vmn2r107	UTSW	17	20375221	missense	probably benign	0.00
R4963:Vmn2r107	UTSW	17	20375141	missense	probably damaging	1.00
R5121:Vmn2r107	UTSW	17	20355753	missense	probably benign	0.01
R5640:Vmn2r107	UTSW	17	20375164	missense	probably damaging	1.00
R6007:Vmn2r107	UTSW	17	20375054	missense	probably benign	0.19
R6238:Vmn2r107	UTSW	17	20345587	missense	probably benign	0.43
R6298:Vmn2r107	UTSW	17	20355782	missense	probably benign	0.00
R6467:Vmn2r107	UTSW	17	20375677	missense	probably damaging	0.99
R6726:Vmn2r107	UTSW	17	20375375	missense	probably damaging	0.96
R6782:Vmn2r107	UTSW	17	20356879	missense	probably damaging	1.00
R7299:Vmn2r107	UTSW	17	20345616	missense	probably benign	0.01
R7301:Vmn2r107	UTSW	17	20345616	missense	probably benign	0.01
R7375:Vmn2r107	UTSW	17	20355876	missense	probably benign
R7448:Vmn2r107	UTSW	17	20375732	missense	probably benign	0.00
R7495:Vmn2r107	UTSW	17	20375009	missense	possibly damaging	0.71
R7589:Vmn2r107	UTSW	17	20375372	missense	probably benign	0.05
R7594:Vmn2r107	UTSW	17	20360373	missense	probably benign	0.03
R7678:Vmn2r107	UTSW	17	20356639	missense	probably benign	0.01
R7929:Vmn2r107	UTSW	17	20345444	missense	probably null	0.96
R7974:Vmn2r107	UTSW	17	20357008	missense	probably benign	0.00
R8040:Vmn2r107	UTSW	17	20375546	missense	probably damaging	1.00
R8263:Vmn2r107	UTSW	17	20360352	missense	probably damaging	1.00
R8426:Vmn2r107	UTSW	17	20356977	missense	possibly damaging	0.91
R9175:Vmn2r107	UTSW	17	20356789	missense	possibly damaging	0.79
R9537:Vmn2r107	UTSW	17	20374887	missense	probably benign	0.00
R9642:Vmn2r107	UTSW	17	20360399	missense	probably damaging	1.00
R9711:Vmn2r107	UTSW	17	20357000	missense	probably damaging	1.00
X0022:Vmn2r107	UTSW	17	20356968	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- GATTCCAACAGATCTGCTATTTGGG -3'
(R):5'- GTACCCATGATCCAAATTTTCTCAC -3'

Sequencing Primer
(F):5'- CAGATCTGCTATTTGGGGAAAATG -3'
(R):5'- ATGATCCAAATTTTCTCACCTGTGG -3'

Posted On

2015-06-20