Incidental Mutation 'R4271:Srpk2'
ID322155
Institutional Source Beutler Lab
Gene Symbol Srpk2
Ensembl Gene ENSMUSG00000062604
Gene Nameserine/arginine-rich protein specific kinase 2
SynonymsWBP6, mSRPK2
MMRRC Submission 041076-MU
Accession Numbers

NCBI RefSeq: NM_009274.2; MGI:1201408

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4271 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location23503264-23684617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23548515 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 80 (H80L)
Ref Sequence ENSEMBL: ENSMUSP00000142554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088392] [ENSMUST00000196388] [ENSMUST00000196929] [ENSMUST00000197985]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088392
AA Change: H80L

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000085734
Gene: ENSMUSG00000062604
AA Change: H80L

DomainStartEndE-ValueType
low complexity region 5 46 N/A INTRINSIC
Pfam:Pkinase 79 228 1.3e-22 PFAM
Pfam:Pkinase_Tyr 79 228 1e-9 PFAM
coiled coil region 263 314 N/A INTRINSIC
coiled coil region 339 373 N/A INTRINSIC
low complexity region 393 406 N/A INTRINSIC
Pfam:Pkinase 506 680 1.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196388
SMART Domains Protein: ENSMUSP00000143453
Gene: ENSMUSG00000062604

DomainStartEndE-ValueType
S_TKc 3 129 7.2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196929
SMART Domains Protein: ENSMUSP00000143216
Gene: ENSMUSG00000062604

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 131 2.6e-8 PFAM
Pfam:Pkinase 2 130 2.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197622
Predicted Effect possibly damaging
Transcript: ENSMUST00000197985
AA Change: H80L

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142554
Gene: ENSMUSG00000062604
AA Change: H80L

DomainStartEndE-ValueType
low complexity region 5 46 N/A INTRINSIC
PDB:2X7G|A 48 129 1e-54 PDB
SCOP:d1howa_ 66 128 1e-13 SMART
Blast:S_TKc 79 128 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198719
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(39) : Targeted(3) Gene trapped(36)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A G 2: 104,026,204 probably benign Het
Acp6 T C 3: 97,166,618 probably null Het
Actr6 T A 10: 89,717,239 R252S probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Ash1l T A 3: 88,982,040 C409S probably benign Het
Aspg T C 12: 112,121,195 S327P probably damaging Het
B430203G13Rik CCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 12: 17,924,357 noncoding transcript Het
BC067074 G T 13: 113,342,370 V1483L possibly damaging Het
C1galt1 T C 6: 7,866,607 F151S probably damaging Het
C1qtnf6 G A 15: 78,525,266 T127I probably benign Het
Ccdc88c G T 12: 100,947,219 Q516K probably damaging Het
Cdh11 T A 8: 102,664,626 D326V possibly damaging Het
Cecr2 C T 6: 120,762,475 H1360Y probably damaging Het
Cfap70 T C 14: 20,420,725 E484G probably benign Het
Chml G A 1: 175,687,794 T187M probably benign Het
Chpt1 C T 10: 88,481,352 probably benign Het
Cmtr1 T C 17: 29,697,982 S618P probably benign Het
Cyfip1 A T 7: 55,879,101 M244L probably benign Het
Dock1 T C 7: 134,734,054 I59T probably damaging Het
Duox1 T C 2: 122,324,375 F414L probably damaging Het
Gm10436 A T 12: 88,178,283 I91K probably damaging Het
Gm1110 A T 9: 26,895,648 probably null Het
Gsap T C 5: 21,226,350 probably null Het
H2-T3 T C 17: 36,189,618 Y111C probably damaging Het
Hectd4 AGCGGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGGCGG 5: 121,220,504 probably benign Het
Kif12 T C 4: 63,170,746 Q146R probably benign Het
Kif26a C T 12: 112,173,414 S460F probably damaging Het
Klhl15 AG A X: 94,253,112 probably null Het
Lims1 T C 10: 58,410,204 probably null Het
Nbr1 T C 11: 101,567,222 Y276H possibly damaging Het
Nfe2l3 A G 6: 51,456,634 D242G probably damaging Het
Oacyl T A 18: 65,737,967 L340Q probably damaging Het
Olfr508 T A 7: 108,630,353 Y120* probably null Het
Olfr733 A T 14: 50,298,451 I286N probably damaging Het
Osbpl5 G T 7: 143,695,602 Y543* probably null Het
Polr1a G A 6: 71,953,022 E898K probably benign Het
Rad54l2 G A 9: 106,693,626 A1165V probably benign Het
Rimbp2 T G 5: 128,819,777 N23T probably benign Het
Scp2 T C 4: 108,085,211 D306G probably damaging Het
Slco4a1 A G 2: 180,474,210 D713G possibly damaging Het
Smarca2 T A 19: 26,720,949 probably null Het
Spem2 T C 11: 69,817,425 Y238C probably damaging Het
Tmem161a T C 8: 70,181,512 L365P probably damaging Het
Tsnax T C 8: 125,032,729 L243P probably damaging Het
Ttn A G 2: 76,901,635 probably benign Het
V1rd19 A G 7: 24,003,414 T102A probably benign Het
Vmn2r94 T C 17: 18,243,678 I783M probably damaging Het
Zeb1 C A 18: 5,758,985 Q148K probably damaging Het
Other mutations in Srpk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Srpk2 APN 5 23540379 missense probably benign 0.10
IGL02057:Srpk2 APN 5 23518707 missense probably damaging 0.99
IGL02217:Srpk2 APN 5 23545570 missense probably damaging 1.00
IGL03115:Srpk2 APN 5 23524618 splice site probably null
FR4737:Srpk2 UTSW 5 23545196 unclassified probably null
P0008:Srpk2 UTSW 5 23513978 missense probably damaging 1.00
R0142:Srpk2 UTSW 5 23527930 missense probably damaging 0.97
R0462:Srpk2 UTSW 5 23518426 missense probably damaging 1.00
R0992:Srpk2 UTSW 5 23545543 missense probably damaging 0.99
R1569:Srpk2 UTSW 5 23514026 missense probably damaging 1.00
R1677:Srpk2 UTSW 5 23525750 splice site probably null
R1696:Srpk2 UTSW 5 23548494 nonsense probably null
R1752:Srpk2 UTSW 5 23528019 missense probably damaging 1.00
R1862:Srpk2 UTSW 5 23524150 missense probably benign 0.32
R1989:Srpk2 UTSW 5 23518423 missense probably damaging 1.00
R2173:Srpk2 UTSW 5 23518615 splice site probably null
R4096:Srpk2 UTSW 5 23540502 intron probably benign
R4894:Srpk2 UTSW 5 23545529 missense probably damaging 1.00
R5043:Srpk2 UTSW 5 23524517 missense probably benign
R5044:Srpk2 UTSW 5 23524392 missense possibly damaging 0.91
R5309:Srpk2 UTSW 5 23525718 missense probably damaging 0.97
R5478:Srpk2 UTSW 5 23524183 missense possibly damaging 0.71
R5568:Srpk2 UTSW 5 23525699 missense possibly damaging 0.73
R5665:Srpk2 UTSW 5 23518477 missense probably damaging 0.99
R5678:Srpk2 UTSW 5 23524606 frame shift probably null
R6364:Srpk2 UTSW 5 23540467 missense probably damaging 1.00
R7201:Srpk2 UTSW 5 23507628 missense possibly damaging 0.64
R7597:Srpk2 UTSW 5 23548519 missense possibly damaging 0.96
RF035:Srpk2 UTSW 5 23525575 utr 3 prime probably benign
RF042:Srpk2 UTSW 5 23525575 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- AAATGCAGACGTGGTGGTTT -3'
(R):5'- AGCAGCATTTCACATTGATATATCA -3'

Sequencing Primer
(F):5'- GGCTGCCTTCAGATTACAATG -3'
(R):5'- GCTGGAATTATAAGCATGAGTCTCCC -3'
Posted On2015-06-20