Incidental Mutation 'R4271:Polr1a'
ID322162
Institutional Source Beutler Lab
Gene Symbol Polr1a
Ensembl Gene ENSMUSG00000049553
Gene Namepolymerase (RNA) I polypeptide A
SynonymsRPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4
MMRRC Submission 041076-MU
Accession Numbers

Genbank: NM_009088; MGI: 1096397

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4271 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location71909053-71984935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71953022 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 898 (E898K)
Ref Sequence ENSEMBL: ENSMUSP00000060858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055296] [ENSMUST00000206556]
Predicted Effect probably benign
Transcript: ENSMUST00000055296
AA Change: E898K

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: E898K

DomainStartEndE-ValueType
RPOLA_N 302 649 8.97e-137 SMART
Pfam:RNA_pol_Rpb1_4 846 958 1.3e-26 PFAM
Pfam:RNA_pol_Rpb1_5 965 1669 7e-103 PFAM
low complexity region 1698 1708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206513
Predicted Effect probably benign
Transcript: ENSMUST00000206556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206982
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A G 2: 104,026,204 probably benign Het
Acp6 T C 3: 97,166,618 probably null Het
Actr6 T A 10: 89,717,239 R252S probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Ash1l T A 3: 88,982,040 C409S probably benign Het
Aspg T C 12: 112,121,195 S327P probably damaging Het
B430203G13Rik CCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 12: 17,924,357 noncoding transcript Het
BC067074 G T 13: 113,342,370 V1483L possibly damaging Het
C1galt1 T C 6: 7,866,607 F151S probably damaging Het
C1qtnf6 G A 15: 78,525,266 T127I probably benign Het
Ccdc88c G T 12: 100,947,219 Q516K probably damaging Het
Cdh11 T A 8: 102,664,626 D326V possibly damaging Het
Cecr2 C T 6: 120,762,475 H1360Y probably damaging Het
Cfap70 T C 14: 20,420,725 E484G probably benign Het
Chml G A 1: 175,687,794 T187M probably benign Het
Chpt1 C T 10: 88,481,352 probably benign Het
Cmtr1 T C 17: 29,697,982 S618P probably benign Het
Cyfip1 A T 7: 55,879,101 M244L probably benign Het
Dock1 T C 7: 134,734,054 I59T probably damaging Het
Duox1 T C 2: 122,324,375 F414L probably damaging Het
Gm10436 A T 12: 88,178,283 I91K probably damaging Het
Gm1110 A T 9: 26,895,648 probably null Het
Gsap T C 5: 21,226,350 probably null Het
H2-T3 T C 17: 36,189,618 Y111C probably damaging Het
Hectd4 AGCGGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGGCGG 5: 121,220,504 probably benign Het
Kif12 T C 4: 63,170,746 Q146R probably benign Het
Kif26a C T 12: 112,173,414 S460F probably damaging Het
Klhl15 AG A X: 94,253,112 probably null Het
Lims1 T C 10: 58,410,204 probably null Het
Nbr1 T C 11: 101,567,222 Y276H possibly damaging Het
Nfe2l3 A G 6: 51,456,634 D242G probably damaging Het
Oacyl T A 18: 65,737,967 L340Q probably damaging Het
Olfr508 T A 7: 108,630,353 Y120* probably null Het
Olfr733 A T 14: 50,298,451 I286N probably damaging Het
Osbpl5 G T 7: 143,695,602 Y543* probably null Het
Rad54l2 G A 9: 106,693,626 A1165V probably benign Het
Rimbp2 T G 5: 128,819,777 N23T probably benign Het
Scp2 T C 4: 108,085,211 D306G probably damaging Het
Slco4a1 A G 2: 180,474,210 D713G possibly damaging Het
Smarca2 T A 19: 26,720,949 probably null Het
Spem2 T C 11: 69,817,425 Y238C probably damaging Het
Srpk2 T A 5: 23,548,515 H80L possibly damaging Het
Tmem161a T C 8: 70,181,512 L365P probably damaging Het
Tsnax T C 8: 125,032,729 L243P probably damaging Het
Ttn A G 2: 76,901,635 probably benign Het
V1rd19 A G 7: 24,003,414 T102A probably benign Het
Vmn2r94 T C 17: 18,243,678 I783M probably damaging Het
Zeb1 C A 18: 5,758,985 Q148K probably damaging Het
Other mutations in Polr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Polr1a APN 6 71948486 missense probably benign 0.32
IGL01834:Polr1a APN 6 71948462 missense probably benign
IGL01902:Polr1a APN 6 71963748 missense probably damaging 1.00
IGL02101:Polr1a APN 6 71950802 missense probably benign 0.00
IGL02325:Polr1a APN 6 71920657 missense probably benign 0.38
IGL02398:Polr1a APN 6 71936556 splice site probably benign
IGL02528:Polr1a APN 6 71964717 missense probably benign
IGL02555:Polr1a APN 6 71920457 missense probably damaging 0.98
IGL02613:Polr1a APN 6 71967320 missense probably damaging 1.00
IGL02693:Polr1a APN 6 71963846 splice site probably benign
IGL02892:Polr1a APN 6 71931696 missense possibly damaging 0.70
IGL03059:Polr1a APN 6 71936512 missense probably benign
IGL03174:Polr1a APN 6 71977347 missense possibly damaging 0.82
D4043:Polr1a UTSW 6 71941417 missense possibly damaging 0.92
R0092:Polr1a UTSW 6 71967455 splice site probably benign
R0217:Polr1a UTSW 6 71963703 missense probably benign 0.19
R0267:Polr1a UTSW 6 71974139 missense probably damaging 0.99
R0329:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0330:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0352:Polr1a UTSW 6 71920763 splice site probably benign
R0411:Polr1a UTSW 6 71978421 missense possibly damaging 0.95
R0446:Polr1a UTSW 6 71950664 critical splice donor site probably null
R0846:Polr1a UTSW 6 71924643 missense probably damaging 1.00
R1035:Polr1a UTSW 6 71967916 missense probably benign
R1294:Polr1a UTSW 6 71912902 missense probably damaging 0.99
R1460:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R1657:Polr1a UTSW 6 71941535 missense probably damaging 1.00
R1846:Polr1a UTSW 6 71976188 missense probably damaging 0.98
R1862:Polr1a UTSW 6 71909203 missense probably damaging 0.96
R1865:Polr1a UTSW 6 71966524 missense probably damaging 1.00
R1903:Polr1a UTSW 6 71967914 missense probably benign 0.02
R1937:Polr1a UTSW 6 71936552 critical splice donor site probably null
R2063:Polr1a UTSW 6 71936285 splice site probably null
R2071:Polr1a UTSW 6 71976074 missense possibly damaging 0.64
R2084:Polr1a UTSW 6 71950809 missense possibly damaging 0.69
R2377:Polr1a UTSW 6 71972826 critical splice donor site probably null
R2410:Polr1a UTSW 6 71974882 missense probably benign
R3001:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3001:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3924:Polr1a UTSW 6 71929450 missense probably benign 0.00
R4105:Polr1a UTSW 6 71976191 missense probably damaging 0.98
R4125:Polr1a UTSW 6 71965706 missense probably benign 0.00
R4440:Polr1a UTSW 6 71950848 missense probably damaging 0.98
R4667:Polr1a UTSW 6 71917821 missense probably benign 0.30
R4769:Polr1a UTSW 6 71950868 missense probably benign 0.01
R4801:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4802:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4828:Polr1a UTSW 6 71966401 missense possibly damaging 0.93
R4911:Polr1a UTSW 6 71909229 missense possibly damaging 0.67
R5071:Polr1a UTSW 6 71931709 missense possibly damaging 0.71
R5165:Polr1a UTSW 6 71967925 missense probably damaging 1.00
R5223:Polr1a UTSW 6 71967907 missense possibly damaging 0.73
R5239:Polr1a UTSW 6 71913037 missense probably damaging 1.00
R5546:Polr1a UTSW 6 71929366 missense possibly damaging 0.64
R5599:Polr1a UTSW 6 71967362 missense possibly damaging 0.95
R5696:Polr1a UTSW 6 71929426 missense probably benign 0.05
R5850:Polr1a UTSW 6 71926683 missense probably benign 0.00
R6274:Polr1a UTSW 6 71954890 splice site probably null
R6526:Polr1a UTSW 6 71929443 missense possibly damaging 0.89
R6578:Polr1a UTSW 6 71976041 missense possibly damaging 0.93
R6660:Polr1a UTSW 6 71967374 missense probably damaging 0.98
R6892:Polr1a UTSW 6 71964712 missense possibly damaging 0.72
R7274:Polr1a UTSW 6 71920516 nonsense probably null
R7291:Polr1a UTSW 6 71941456 missense probably benign 0.02
R7311:Polr1a UTSW 6 71950879 missense possibly damaging 0.53
R7431:Polr1a UTSW 6 71926659 missense probably benign 0.14
R7479:Polr1a UTSW 6 71936297 missense probably damaging 1.00
R7607:Polr1a UTSW 6 71913021 missense probably benign
R7739:Polr1a UTSW 6 71954835 missense possibly damaging 0.94
R7746:Polr1a UTSW 6 71941512 missense probably damaging 1.00
R7764:Polr1a UTSW 6 71953070 missense probably damaging 1.00
R7835:Polr1a UTSW 6 71915142 missense probably benign 0.02
R8029:Polr1a UTSW 6 71912956 nonsense probably null
R8057:Polr1a UTSW 6 71931660 missense possibly damaging 0.95
R8144:Polr1a UTSW 6 71950616 missense probably benign
R8170:Polr1a UTSW 6 71920749 missense probably benign
R8320:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R8328:Polr1a UTSW 6 71920734 missense probably benign
R8331:Polr1a UTSW 6 71976179 missense probably damaging 1.00
R8362:Polr1a UTSW 6 71964667 missense probably benign 0.00
R8511:Polr1a UTSW 6 71920520 missense probably benign 0.01
R8709:Polr1a UTSW 6 71974848 missense probably benign
R8745:Polr1a UTSW 6 71954771 missense probably damaging 1.00
R8784:Polr1a UTSW 6 71950628 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGGACACATCTATAGGCTTTAG -3'
(R):5'- TGCTTCAGGGCTTTCTAGTC -3'

Sequencing Primer
(F):5'- AGGATAATCCAGATAAGGCTTTCC -3'
(R):5'- CTTCAGGGCTTTCTAGTCTTGTTAG -3'
Posted On2015-06-20