Incidental Mutation 'R4271:Gm1110'
ID322174
Institutional Source Beutler Lab
Gene Symbol Gm1110
Ensembl Gene ENSMUSG00000079644
Gene Namepredicted gene 1110
SynonymsLOC382064
MMRRC Submission 041076-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4271 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location26879567-26923111 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 26895648 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115261]
Predicted Effect probably null
Transcript: ENSMUST00000115261
SMART Domains Protein: ENSMUSP00000110916
Gene: ENSMUSG00000079644

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_35 55 368 2e-93 PFAM
Pfam:Glyco_hydro_42 70 229 1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217197
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A G 2: 104,026,204 probably benign Het
Acp6 T C 3: 97,166,618 probably null Het
Actr6 T A 10: 89,717,239 R252S probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Ash1l T A 3: 88,982,040 C409S probably benign Het
Aspg T C 12: 112,121,195 S327P probably damaging Het
B430203G13Rik CCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 12: 17,924,357 noncoding transcript Het
BC067074 G T 13: 113,342,370 V1483L possibly damaging Het
C1galt1 T C 6: 7,866,607 F151S probably damaging Het
C1qtnf6 G A 15: 78,525,266 T127I probably benign Het
Ccdc88c G T 12: 100,947,219 Q516K probably damaging Het
Cdh11 T A 8: 102,664,626 D326V possibly damaging Het
Cecr2 C T 6: 120,762,475 H1360Y probably damaging Het
Cfap70 T C 14: 20,420,725 E484G probably benign Het
Chml G A 1: 175,687,794 T187M probably benign Het
Chpt1 C T 10: 88,481,352 probably benign Het
Cmtr1 T C 17: 29,697,982 S618P probably benign Het
Cyfip1 A T 7: 55,879,101 M244L probably benign Het
Dock1 T C 7: 134,734,054 I59T probably damaging Het
Duox1 T C 2: 122,324,375 F414L probably damaging Het
Gm10436 A T 12: 88,178,283 I91K probably damaging Het
Gsap T C 5: 21,226,350 probably null Het
H2-T3 T C 17: 36,189,618 Y111C probably damaging Het
Hectd4 AGCGGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGGCGG 5: 121,220,504 probably benign Het
Kif12 T C 4: 63,170,746 Q146R probably benign Het
Kif26a C T 12: 112,173,414 S460F probably damaging Het
Klhl15 AG A X: 94,253,112 probably null Het
Lims1 T C 10: 58,410,204 probably null Het
Nbr1 T C 11: 101,567,222 Y276H possibly damaging Het
Nfe2l3 A G 6: 51,456,634 D242G probably damaging Het
Oacyl T A 18: 65,737,967 L340Q probably damaging Het
Olfr508 T A 7: 108,630,353 Y120* probably null Het
Olfr733 A T 14: 50,298,451 I286N probably damaging Het
Osbpl5 G T 7: 143,695,602 Y543* probably null Het
Polr1a G A 6: 71,953,022 E898K probably benign Het
Rad54l2 G A 9: 106,693,626 A1165V probably benign Het
Rimbp2 T G 5: 128,819,777 N23T probably benign Het
Scp2 T C 4: 108,085,211 D306G probably damaging Het
Slco4a1 A G 2: 180,474,210 D713G possibly damaging Het
Smarca2 T A 19: 26,720,949 probably null Het
Spem2 T C 11: 69,817,425 Y238C probably damaging Het
Srpk2 T A 5: 23,548,515 H80L possibly damaging Het
Tmem161a T C 8: 70,181,512 L365P probably damaging Het
Tsnax T C 8: 125,032,729 L243P probably damaging Het
Ttn A G 2: 76,901,635 probably benign Het
V1rd19 A G 7: 24,003,414 T102A probably benign Het
Vmn2r94 T C 17: 18,243,678 I783M probably damaging Het
Zeb1 C A 18: 5,758,985 Q148K probably damaging Het
Other mutations in Gm1110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Gm1110 APN 9 26880874 nonsense probably null
IGL01089:Gm1110 APN 9 26881860 missense probably benign
IGL01631:Gm1110 APN 9 26897916 critical splice donor site probably null
IGL02008:Gm1110 APN 9 26883230 missense probably benign 0.09
IGL02331:Gm1110 APN 9 26913287 critical splice donor site probably null
IGL02335:Gm1110 APN 9 26881763 missense probably benign 0.00
IGL02550:Gm1110 APN 9 26881834 missense probably benign 0.09
IGL02614:Gm1110 APN 9 26920714 missense probably benign 0.11
IGL03409:Gm1110 APN 9 26896620 missense probably benign 0.21
PIT4458001:Gm1110 UTSW 9 26880828 missense probably benign 0.00
R0189:Gm1110 UTSW 9 26883218 missense probably null 0.99
R0271:Gm1110 UTSW 9 26920666 missense probably damaging 1.00
R1034:Gm1110 UTSW 9 26921350 missense probably damaging 1.00
R1229:Gm1110 UTSW 9 26881806 missense probably benign
R1355:Gm1110 UTSW 9 26883761 missense probably benign 0.01
R1566:Gm1110 UTSW 9 26880870 missense probably damaging 1.00
R1574:Gm1110 UTSW 9 26881126 splice site probably benign
R1916:Gm1110 UTSW 9 26889638 missense probably damaging 1.00
R2011:Gm1110 UTSW 9 26894258 missense probably benign 0.01
R2214:Gm1110 UTSW 9 26902490 missense probably benign 0.37
R2567:Gm1110 UTSW 9 26920696 missense probably benign
R2967:Gm1110 UTSW 9 26881043 missense probably benign 0.05
R4683:Gm1110 UTSW 9 26920594 missense probably damaging 0.99
R4945:Gm1110 UTSW 9 26920595 missense possibly damaging 0.46
R5015:Gm1110 UTSW 9 26881866 missense probably benign 0.01
R5089:Gm1110 UTSW 9 26882387 missense probably damaging 0.96
R5225:Gm1110 UTSW 9 26902478 missense probably damaging 1.00
R5239:Gm1110 UTSW 9 26893570 missense probably benign 0.00
R5395:Gm1110 UTSW 9 26889632 missense probably benign
R5783:Gm1110 UTSW 9 26882336 missense probably benign
R6045:Gm1110 UTSW 9 26883209 critical splice donor site probably null
R6245:Gm1110 UTSW 9 26920747 missense probably benign 0.04
R6357:Gm1110 UTSW 9 26914128 splice site probably null
R6863:Gm1110 UTSW 9 26881064 missense probably damaging 1.00
R7336:Gm1110 UTSW 9 26914357 missense probably damaging 0.99
R7454:Gm1110 UTSW 9 26920649 missense probably benign
R7555:Gm1110 UTSW 9 26893628 missense probably benign 0.05
R7579:Gm1110 UTSW 9 26883826 missense possibly damaging 0.93
R7990:Gm1110 UTSW 9 26880841 missense possibly damaging 0.66
R8062:Gm1110 UTSW 9 26881821 missense probably damaging 0.99
R8108:Gm1110 UTSW 9 26920661 missense probably damaging 1.00
R8323:Gm1110 UTSW 9 26902423 critical splice donor site probably null
R8354:Gm1110 UTSW 9 26883280 missense probably benign 0.01
R8354:Gm1110 UTSW 9 26883281 missense probably benign 0.00
RF002:Gm1110 UTSW 9 26920640 missense probably damaging 1.00
X0063:Gm1110 UTSW 9 26894280 missense probably benign 0.01
Z1088:Gm1110 UTSW 9 26913310 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTTCCACGTAGCAGATAAGC -3'
(R):5'- AAGTCTCCGAGCTGTGAATTC -3'

Sequencing Primer
(F):5'- GTTCCACGTAGCAGATAAGCAAGAC -3'
(R):5'- CCGAGCTGTGAATTCTTAAATCC -3'
Posted On2015-06-20