Incidental Mutation 'R4271:Olfr733'
ID322187
Institutional Source Beutler Lab
Gene Symbol Olfr733
Ensembl Gene ENSMUSG00000090874
Gene Nameolfactory receptor 733
SynonymsMOR241-2, GA_x6K02T2PMLR-5992342-5991416
MMRRC Submission 041076-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R4271 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location50295891-50301522 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50298451 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 286 (I286N)
Ref Sequence ENSEMBL: ENSMUSP00000149807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163469] [ENSMUST00000214372] [ENSMUST00000214756] [ENSMUST00000216195]
Predicted Effect probably damaging
Transcript: ENSMUST00000163469
AA Change: I286N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128332
Gene: ENSMUSG00000090874
AA Change: I286N

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 6.4e-41 PFAM
Pfam:7tm_1 41 288 1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214372
AA Change: I286N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214756
AA Change: I286N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216195
AA Change: I286N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A G 2: 104,026,204 probably benign Het
Acp6 T C 3: 97,166,618 probably null Het
Actr6 T A 10: 89,717,239 R252S probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Ash1l T A 3: 88,982,040 C409S probably benign Het
Aspg T C 12: 112,121,195 S327P probably damaging Het
B430203G13Rik CCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 12: 17,924,357 noncoding transcript Het
BC067074 G T 13: 113,342,370 V1483L possibly damaging Het
C1galt1 T C 6: 7,866,607 F151S probably damaging Het
C1qtnf6 G A 15: 78,525,266 T127I probably benign Het
Ccdc88c G T 12: 100,947,219 Q516K probably damaging Het
Cdh11 T A 8: 102,664,626 D326V possibly damaging Het
Cecr2 C T 6: 120,762,475 H1360Y probably damaging Het
Cfap70 T C 14: 20,420,725 E484G probably benign Het
Chml G A 1: 175,687,794 T187M probably benign Het
Chpt1 C T 10: 88,481,352 probably benign Het
Cmtr1 T C 17: 29,697,982 S618P probably benign Het
Cyfip1 A T 7: 55,879,101 M244L probably benign Het
Dock1 T C 7: 134,734,054 I59T probably damaging Het
Duox1 T C 2: 122,324,375 F414L probably damaging Het
Gm10436 A T 12: 88,178,283 I91K probably damaging Het
Gm1110 A T 9: 26,895,648 probably null Het
Gsap T C 5: 21,226,350 probably null Het
H2-T3 T C 17: 36,189,618 Y111C probably damaging Het
Hectd4 AGCGGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGGCGG 5: 121,220,504 probably benign Het
Kif12 T C 4: 63,170,746 Q146R probably benign Het
Kif26a C T 12: 112,173,414 S460F probably damaging Het
Klhl15 AG A X: 94,253,112 probably null Het
Lims1 T C 10: 58,410,204 probably null Het
Nbr1 T C 11: 101,567,222 Y276H possibly damaging Het
Nfe2l3 A G 6: 51,456,634 D242G probably damaging Het
Oacyl T A 18: 65,737,967 L340Q probably damaging Het
Olfr508 T A 7: 108,630,353 Y120* probably null Het
Osbpl5 G T 7: 143,695,602 Y543* probably null Het
Polr1a G A 6: 71,953,022 E898K probably benign Het
Rad54l2 G A 9: 106,693,626 A1165V probably benign Het
Rimbp2 T G 5: 128,819,777 N23T probably benign Het
Scp2 T C 4: 108,085,211 D306G probably damaging Het
Slco4a1 A G 2: 180,474,210 D713G possibly damaging Het
Smarca2 T A 19: 26,720,949 probably null Het
Spem2 T C 11: 69,817,425 Y238C probably damaging Het
Srpk2 T A 5: 23,548,515 H80L possibly damaging Het
Tmem161a T C 8: 70,181,512 L365P probably damaging Het
Tsnax T C 8: 125,032,729 L243P probably damaging Het
Ttn A G 2: 76,901,635 probably benign Het
V1rd19 A G 7: 24,003,414 T102A probably benign Het
Vmn2r94 T C 17: 18,243,678 I783M probably damaging Het
Zeb1 C A 18: 5,758,985 Q148K probably damaging Het
Other mutations in Olfr733
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Olfr733 APN 14 50298512 missense probably benign 0.00
IGL02247:Olfr733 APN 14 50299114 missense probably damaging 1.00
IGL02307:Olfr733 APN 14 50298838 missense probably damaging 1.00
IGL02492:Olfr733 APN 14 50298603 missense probably damaging 1.00
PIT4378001:Olfr733 UTSW 14 50298898 missense probably benign
R0544:Olfr733 UTSW 14 50298682 missense probably benign 0.20
R1603:Olfr733 UTSW 14 50299034 missense possibly damaging 0.95
R1881:Olfr733 UTSW 14 50299015 missense probably damaging 1.00
R3731:Olfr733 UTSW 14 50298505 missense probably damaging 1.00
R4512:Olfr733 UTSW 14 50298996 missense probably damaging 1.00
R5601:Olfr733 UTSW 14 50298861 missense probably damaging 1.00
R6468:Olfr733 UTSW 14 50298467 missense probably benign 0.02
R6614:Olfr733 UTSW 14 50299037 missense probably benign 0.00
R7013:Olfr733 UTSW 14 50299199 missense probably damaging 0.99
R7083:Olfr733 UTSW 14 50299279 missense possibly damaging 0.81
R7274:Olfr733 UTSW 14 50298422 missense probably benign 0.01
R7493:Olfr733 UTSW 14 50298824 missense probably benign 0.02
R7653:Olfr733 UTSW 14 50299147 missense possibly damaging 0.82
R7659:Olfr733 UTSW 14 50299241 missense probably benign 0.00
R7885:Olfr733 UTSW 14 50298584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTATGTATAAACGCATCAAGTTGC -3'
(R):5'- TTTTATGCCATGTTCACAGGTCAG -3'

Sequencing Primer
(F):5'- GTCAAATCTTTCCTGCCTGA -3'
(R):5'- TCACAGGTCAGCTTCTGAAG -3'
Posted On2015-06-20