Mutagenetix > Incidental Mutation

Incidental Mutation 'R4271:Zeb1'

322192

Institutional Source

Beutler Lab

Gene Symbol

Zeb1

Ensembl Gene

ENSMUSG00000024238

Gene Name

zinc finger E-box binding homeobox 1

Synonyms

3110032K11Rik, Tw, MEB1, Zfhx1a, Zfhep, ZEB, AREB6, Zfx1a, Tcf18, Nil2, Tcf8, [delta]EF1

MMRRC Submission

041076-MU

Accession Numbers

Genbank: NM_011546; MGI: 1344313

Is this an essential gene?

Probably essential (E-score: 0.954) question?

Stock #

R4271 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

5591860-5775467 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 5758985 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 148 (Q148K)

Ref Sequence

ENSEMBL: ENSMUSP00000025081 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025081] [ENSMUST00000159390] [ENSMUST00000160910] [ENSMUST00000175925]

AlphaFold

Q64318

Predicted Effect

probably damaging
Transcript: ENSMUST00000025081
AA Change: Q148K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000025081
Gene: ENSMUSG00000024238
AA Change: Q148K

Domain	Start	End	E-Value	Type
low complexity region	13	30	N/A	INTRINSIC
ZnF_C2H2	150	173	3.16e-3	SMART
ZnF_C2H2	180	202	3.21e-4	SMART
ZnF_C2H2	220	242	4.87e-4	SMART
ZnF_C2H2	248	268	1.86e1	SMART
low complexity region	288	304	N/A	INTRINSIC
low complexity region	532	555	N/A	INTRINSIC
HOX	559	621	7.53e-3	SMART
low complexity region	730	742	N/A	INTRINSIC
low complexity region	766	783	N/A	INTRINSIC
ZnF_C2H2	882	904	1.18e-2	SMART
ZnF_C2H2	910	932	4.4e-2	SMART
ZnF_C2H2	938	959	1.89e-1	SMART
coiled coil region	1006	1077	N/A	INTRINSIC
low complexity region	1096	1112	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159390
AA Change: Q94K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000124395
Gene: ENSMUSG00000024238
AA Change: Q94K

Domain	Start	End	E-Value	Type
low complexity region	13	30	N/A	INTRINSIC
ZnF_C2H2	96	119	3.16e-3	SMART
ZnF_C2H2	126	148	3.21e-4	SMART
ZnF_C2H2	166	188	4.87e-4	SMART
ZnF_C2H2	194	214	1.86e1	SMART
low complexity region	234	250	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000160910
AA Change: Q131K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124815
Gene: ENSMUSG00000024238
AA Change: Q131K

Domain	Start	End	E-Value	Type
ZnF_C2H2	133	153	1.2e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161295

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162892

SMART Domains

Protein: ENSMUSP00000124677
Gene: ENSMUSG00000024238

Domain	Start	End	E-Value	Type
ZnF_C2H2	94	117	1.3e-5	SMART
ZnF_C2H2	124	146	1.3e-6	SMART
ZnF_C2H2	164	186	2e-6	SMART
ZnF_C2H2	192	212	7.8e-2	SMART
low complexity region	232	248	N/A	INTRINSIC
low complexity region	476	499	N/A	INTRINSIC
HOX	503	565	3.9e-5	SMART
low complexity region	674	686	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175925

SMART Domains

Protein: ENSMUSP00000135125
Gene: ENSMUSG00000024238

Domain	Start	End	E-Value	Type
ZnF_C2H2	130	153	3.16e-3	SMART
ZnF_C2H2	160	182	3.21e-4	SMART
ZnF_C2H2	200	222	4.87e-4	SMART
ZnF_C2H2	228	248	1.86e1	SMART
low complexity region	268	284	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177030

SMART Domains

Protein: ENSMUSP00000135865
Gene: ENSMUSG00000024238

Domain	Start	End	E-Value	Type
ZnF_C2H2	22	44	4.87e-4	SMART
low complexity region	277	300	N/A	INTRINSIC
HOX	304	366	7.53e-3	SMART
low complexity region	475	487	N/A	INTRINSIC
low complexity region	511	528	N/A	INTRINSIC
ZnF_C2H2	627	649	1.18e-2	SMART
ZnF_C2H2	655	677	4.4e-2	SMART
ZnF_C2H2	683	704	1.89e-1	SMART
low complexity region	758	775	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177070

SMART Domains

Protein: ENSMUSP00000135543
Gene: ENSMUSG00000024238

Domain	Start	End	E-Value	Type
ZnF_C2H2	130	153	3.16e-3	SMART
ZnF_C2H2	160	182	3.21e-4	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger transcription factor. The encoded protein likely plays a role in transcriptional repression of interleukin 2. Mutations in this gene have been associated with posterior polymorphous corneal dystrophy-3 and late-onset Fuchs endothelial corneal dystrophy. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mutations at this locus affect thymus organization and homozygotes exhibit severe thymic T cell deficiency. Some mutations result in eye anomalies and extensive skeletal abnormalities. Homozygotes generally die at birth due to respiratory failure. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931422A03Rik	A	G	2: 104,026,204		probably benign	Het
Acp6	T	C	3: 97,166,618		probably null	Het
Actr6	T	A	10: 89,717,239	R252S	probably benign	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 118,121,899		probably benign	Het
Ash1l	T	A	3: 88,982,040	C409S	probably benign	Het
Aspg	T	C	12: 112,121,195	S327P	probably damaging	Het
B430203G13Rik	CCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT	CCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT	12: 17,924,357		noncoding transcript	Het
BC067074	G	T	13: 113,342,370	V1483L	possibly damaging	Het
C1galt1	T	C	6: 7,866,607	F151S	probably damaging	Het
C1qtnf6	G	A	15: 78,525,266	T127I	probably benign	Het
Ccdc88c	G	T	12: 100,947,219	Q516K	probably damaging	Het
Cdh11	T	A	8: 102,664,626	D326V	possibly damaging	Het
Cecr2	C	T	6: 120,762,475	H1360Y	probably damaging	Het
Cfap70	T	C	14: 20,420,725	E484G	probably benign	Het
Chml	G	A	1: 175,687,794	T187M	probably benign	Het
Chpt1	C	T	10: 88,481,352		probably benign	Het
Cmtr1	T	C	17: 29,697,982	S618P	probably benign	Het
Cyfip1	A	T	7: 55,879,101	M244L	probably benign	Het
Dock1	T	C	7: 134,734,054	I59T	probably damaging	Het
Duox1	T	C	2: 122,324,375	F414L	probably damaging	Het
Gm10436	A	T	12: 88,178,283	I91K	probably damaging	Het
Gm1110	A	T	9: 26,895,648		probably null	Het
Gsap	T	C	5: 21,226,350		probably null	Het
H2-T3	T	C	17: 36,189,618	Y111C	probably damaging	Het
Hectd4	AGCGGCGGCGGCGGCGGCGGCGG	AGCGGCGGCGGCGGCGGCGG	5: 121,220,504		probably benign	Het
Kif12	T	C	4: 63,170,746	Q146R	probably benign	Het
Kif26a	C	T	12: 112,173,414	S460F	probably damaging	Het
Klhl15	AG	A	X: 94,253,112		probably null	Het
Lims1	T	C	10: 58,410,204		probably null	Het
Nbr1	T	C	11: 101,567,222	Y276H	possibly damaging	Het
Nfe2l3	A	G	6: 51,456,634	D242G	probably damaging	Het
Oacyl	T	A	18: 65,737,967	L340Q	probably damaging	Het
Olfr508	T	A	7: 108,630,353	Y120*	probably null	Het
Olfr733	A	T	14: 50,298,451	I286N	probably damaging	Het
Osbpl5	G	T	7: 143,695,602	Y543*	probably null	Het
Polr1a	G	A	6: 71,953,022	E898K	probably benign	Het
Rad54l2	G	A	9: 106,693,626	A1165V	probably benign	Het
Rimbp2	T	G	5: 128,819,777	N23T	probably benign	Het
Scp2	T	C	4: 108,085,211	D306G	probably damaging	Het
Slco4a1	A	G	2: 180,474,210	D713G	possibly damaging	Het
Smarca2	T	A	19: 26,720,949		probably null	Het
Spem2	T	C	11: 69,817,425	Y238C	probably damaging	Het
Srpk2	T	A	5: 23,548,515	H80L	possibly damaging	Het
Tmem161a	T	C	8: 70,181,512	L365P	probably damaging	Het
Tsnax	T	C	8: 125,032,729	L243P	probably damaging	Het
Ttn	A	G	2: 76,901,635		probably benign	Het
V1rd19	A	G	7: 24,003,414	T102A	probably benign	Het
Vmn2r94	T	C	17: 18,243,678	I783M	probably damaging	Het

Other mutations in Zeb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00833:Zeb1	APN	18	5767774	missense	probably benign	0.00
IGL01139:Zeb1	APN	18	5705061	missense	possibly damaging	0.69
IGL01444:Zeb1	APN	18	5767906	missense	probably damaging	1.00
IGL01444:Zeb1	APN	18	5767138	missense	probably benign
IGL01806:Zeb1	APN	18	5767867	missense	possibly damaging	0.94
IGL01988:Zeb1	APN	18	5759037	nonsense	probably null
IGL02059:Zeb1	APN	18	5766892	missense	probably damaging	1.00
IGL03005:Zeb1	APN	18	5767150	missense	probably benign	0.03
IGL03153:Zeb1	APN	18	5770511	missense	probably damaging	1.00
Apes	UTSW	18	5761394	missense	probably damaging	1.00
cellophane	UTSW	18	5770554	nonsense	probably null
serpens	UTSW	18	5772455	missense	probably damaging	1.00
N/A - 293:Zeb1	UTSW	18	5767076	missense	possibly damaging	0.68
R0184:Zeb1	UTSW	18	5766808	missense	probably damaging	1.00
R0488:Zeb1	UTSW	18	5772455	missense	probably damaging	1.00
R0622:Zeb1	UTSW	18	5759123	nonsense	probably null
R0646:Zeb1	UTSW	18	5759027	missense	probably damaging	1.00
R0881:Zeb1	UTSW	18	5767138	missense	probably benign
R1251:Zeb1	UTSW	18	5705089	missense	probably damaging	1.00
R1257:Zeb1	UTSW	18	5772699	missense	possibly damaging	0.53
R1501:Zeb1	UTSW	18	5761399	missense	possibly damaging	0.95
R1547:Zeb1	UTSW	18	5767450	missense	possibly damaging	0.50
R1797:Zeb1	UTSW	18	5766298	nonsense	probably null
R1815:Zeb1	UTSW	18	5767898	missense	probably damaging	1.00
R2090:Zeb1	UTSW	18	5766458	missense	possibly damaging	0.65
R2129:Zeb1	UTSW	18	5767681	missense	possibly damaging	0.92
R2875:Zeb1	UTSW	18	5772859	small insertion	probably benign
R3888:Zeb1	UTSW	18	5748743	missense	probably damaging	1.00
R3941:Zeb1	UTSW	18	5767799	missense	probably benign	0.06
R3952:Zeb1	UTSW	18	5772716	missense	probably benign	0.17
R4512:Zeb1	UTSW	18	5759007	missense	probably damaging	1.00
R4514:Zeb1	UTSW	18	5759007	missense	probably damaging	1.00
R4677:Zeb1	UTSW	18	5766775	missense	probably damaging	0.97
R4729:Zeb1	UTSW	18	5767286	missense	probably damaging	1.00
R5839:Zeb1	UTSW	18	5767507	missense	probably benign
R5913:Zeb1	UTSW	18	5766765	missense	possibly damaging	0.49
R6248:Zeb1	UTSW	18	5766962	missense	probably damaging	1.00
R6354:Zeb1	UTSW	18	5772743	missense	possibly damaging	0.64
R6429:Zeb1	UTSW	18	5770498	missense	probably damaging	1.00
R6819:Zeb1	UTSW	18	5591917	missense	probably damaging	1.00
R7180:Zeb1	UTSW	18	5767867	missense	possibly damaging	0.94
R7193:Zeb1	UTSW	18	5772756	missense	probably damaging	0.98
R7199:Zeb1	UTSW	18	5767703	missense	probably benign	0.00
R7397:Zeb1	UTSW	18	5761394	missense	probably damaging	1.00
R7534:Zeb1	UTSW	18	5766611	missense	probably damaging	1.00
R7702:Zeb1	UTSW	18	5766802	missense	probably damaging	1.00
R7703:Zeb1	UTSW	18	5766917	missense	probably benign
R7934:Zeb1	UTSW	18	5748703	missense	probably benign	0.00
R8504:Zeb1	UTSW	18	5705127	missense	possibly damaging	0.94
R8539:Zeb1	UTSW	18	5748784	missense	probably damaging	0.99
R8716:Zeb1	UTSW	18	5767958	missense	probably damaging	0.99
R8772:Zeb1	UTSW	18	5770382	critical splice acceptor site	probably null
R8824:Zeb1	UTSW	18	5748680	splice site	probably benign
R9082:Zeb1	UTSW	18	5772557	missense	probably damaging	0.98
R9085:Zeb1	UTSW	18	5766716	missense	probably damaging	1.00
R9274:Zeb1	UTSW	18	5772840	small deletion	probably benign
R9456:Zeb1	UTSW	18	5766709	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CATTTTCTCATGCATACCTGGAGG -3'
(R):5'- AAGCTTCCCTGAGTCACCAG -3'

Sequencing Primer
(F):5'- GTGTCATCCACCCTTCATCTTTGG -3'
(R):5'- TGAGTCACCAGGTGCCCATC -3'

Posted On

2015-06-20