Incidental Mutation 'R4271:Oacyl'
ID322193
Institutional Source Beutler Lab
Gene Symbol Oacyl
Ensembl Gene ENSMUSG00000046610
Gene NameO-acyltransferase like
Synonyms5330437I02Rik
MMRRC Submission 041076-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4271 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location65698268-65751601 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65737967 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 340 (L340Q)
Ref Sequence ENSEMBL: ENSMUSP00000113626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115097] [ENSMUST00000117694]
Predicted Effect probably damaging
Transcript: ENSMUST00000115097
AA Change: L413Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110749
Gene: ENSMUSG00000046610
AA Change: L413Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
NRF 24 145 3.58e-13 SMART
Blast:NRF 152 191 1e-6 BLAST
Pfam:Acyl_transf_3 274 664 6.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117694
AA Change: L340Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113626
Gene: ENSMUSG00000046610
AA Change: L340Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:NRF 24 118 4e-14 BLAST
Pfam:Acyl_transf_3 201 591 6.7e-23 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A G 2: 104,026,204 probably benign Het
Acp6 T C 3: 97,166,618 probably null Het
Actr6 T A 10: 89,717,239 R252S probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Ash1l T A 3: 88,982,040 C409S probably benign Het
Aspg T C 12: 112,121,195 S327P probably damaging Het
B430203G13Rik CCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 12: 17,924,357 noncoding transcript Het
BC067074 G T 13: 113,342,370 V1483L possibly damaging Het
C1galt1 T C 6: 7,866,607 F151S probably damaging Het
C1qtnf6 G A 15: 78,525,266 T127I probably benign Het
Ccdc88c G T 12: 100,947,219 Q516K probably damaging Het
Cdh11 T A 8: 102,664,626 D326V possibly damaging Het
Cecr2 C T 6: 120,762,475 H1360Y probably damaging Het
Cfap70 T C 14: 20,420,725 E484G probably benign Het
Chml G A 1: 175,687,794 T187M probably benign Het
Chpt1 C T 10: 88,481,352 probably benign Het
Cmtr1 T C 17: 29,697,982 S618P probably benign Het
Cyfip1 A T 7: 55,879,101 M244L probably benign Het
Dock1 T C 7: 134,734,054 I59T probably damaging Het
Duox1 T C 2: 122,324,375 F414L probably damaging Het
Gm10436 A T 12: 88,178,283 I91K probably damaging Het
Gm1110 A T 9: 26,895,648 probably null Het
Gsap T C 5: 21,226,350 probably null Het
H2-T3 T C 17: 36,189,618 Y111C probably damaging Het
Hectd4 AGCGGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGGCGG 5: 121,220,504 probably benign Het
Kif12 T C 4: 63,170,746 Q146R probably benign Het
Kif26a C T 12: 112,173,414 S460F probably damaging Het
Klhl15 AG A X: 94,253,112 probably null Het
Lims1 T C 10: 58,410,204 probably null Het
Nbr1 T C 11: 101,567,222 Y276H possibly damaging Het
Nfe2l3 A G 6: 51,456,634 D242G probably damaging Het
Olfr508 T A 7: 108,630,353 Y120* probably null Het
Olfr733 A T 14: 50,298,451 I286N probably damaging Het
Osbpl5 G T 7: 143,695,602 Y543* probably null Het
Polr1a G A 6: 71,953,022 E898K probably benign Het
Rad54l2 G A 9: 106,693,626 A1165V probably benign Het
Rimbp2 T G 5: 128,819,777 N23T probably benign Het
Scp2 T C 4: 108,085,211 D306G probably damaging Het
Slco4a1 A G 2: 180,474,210 D713G possibly damaging Het
Smarca2 T A 19: 26,720,949 probably null Het
Spem2 T C 11: 69,817,425 Y238C probably damaging Het
Srpk2 T A 5: 23,548,515 H80L possibly damaging Het
Tmem161a T C 8: 70,181,512 L365P probably damaging Het
Tsnax T C 8: 125,032,729 L243P probably damaging Het
Ttn A G 2: 76,901,635 probably benign Het
V1rd19 A G 7: 24,003,414 T102A probably benign Het
Vmn2r94 T C 17: 18,243,678 I783M probably damaging Het
Zeb1 C A 18: 5,758,985 Q148K probably damaging Het
Other mutations in Oacyl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Oacyl APN 18 65749640 missense possibly damaging 0.65
IGL00972:Oacyl APN 18 65725501 missense possibly damaging 0.95
IGL01970:Oacyl APN 18 65749714 missense possibly damaging 0.77
IGL02030:Oacyl APN 18 65737910 missense probably damaging 0.99
IGL02706:Oacyl APN 18 65749721 missense probably damaging 1.00
R0529:Oacyl UTSW 18 65742219 missense probably damaging 0.97
R0607:Oacyl UTSW 18 65747891 missense possibly damaging 0.61
R0724:Oacyl UTSW 18 65737825 splice site probably benign
R1138:Oacyl UTSW 18 65725450 missense probably damaging 1.00
R1482:Oacyl UTSW 18 65737972 missense probably damaging 1.00
R1551:Oacyl UTSW 18 65742209 missense probably benign 0.02
R1649:Oacyl UTSW 18 65750096 missense probably damaging 1.00
R1919:Oacyl UTSW 18 65710547 missense possibly damaging 0.87
R5443:Oacyl UTSW 18 65750182 missense probably benign
R5525:Oacyl UTSW 18 65745356 missense probably benign 0.00
R5879:Oacyl UTSW 18 65749672 missense probably damaging 1.00
R6132:Oacyl UTSW 18 65726355 missense probably damaging 1.00
R6367:Oacyl UTSW 18 65725444 missense probably damaging 1.00
R7009:Oacyl UTSW 18 65722538 nonsense probably null
R7097:Oacyl UTSW 18 65720252 missense probably benign 0.00
R7122:Oacyl UTSW 18 65720252 missense probably benign 0.00
R7132:Oacyl UTSW 18 65698409 missense probably damaging 1.00
R7260:Oacyl UTSW 18 65698367 missense probably damaging 1.00
R7403:Oacyl UTSW 18 65737895 missense probably benign 0.15
R7501:Oacyl UTSW 18 65725298 splice site probably null
R7759:Oacyl UTSW 18 65710560 missense probably damaging 1.00
R7892:Oacyl UTSW 18 65737847 missense probably benign 0.00
R7921:Oacyl UTSW 18 65725383 missense probably benign
R7977:Oacyl UTSW 18 65698391 missense probably benign 0.18
R7987:Oacyl UTSW 18 65698391 missense probably benign 0.18
Z1177:Oacyl UTSW 18 65725347 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACAGGTTCCTTCAAGCATCCC -3'
(R):5'- CCTACATCAGCTGGTGTCATAC -3'

Sequencing Primer
(F):5'- ACCTCCTGAATGTCCACTGAGG -3'
(R):5'- CCTTCAAAACTCATGGAGATGG -3'
Posted On2015-06-20