Incidental Mutation 'R4272:Arl5b'
ID322199
Institutional Source Beutler Lab
Gene Symbol Arl5b
Ensembl Gene ENSMUSG00000017418
Gene NameADP-ribosylation factor-like 5B
Synonyms4930587A11Rik, Arl8
MMRRC Submission 041644-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4272 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location15049395-15082456 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15073179 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 105 (E105G)
Ref Sequence ENSEMBL: ENSMUSP00000069725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017562] [ENSMUST00000069870] [ENSMUST00000128682] [ENSMUST00000193836]
Predicted Effect probably damaging
Transcript: ENSMUST00000017562
AA Change: E96G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017562
Gene: ENSMUSG00000017418
AA Change: E96G

DomainStartEndE-ValueType
ARF 4 171 4.8e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000069870
AA Change: E105G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069725
Gene: ENSMUSG00000017418
AA Change: E105G

DomainStartEndE-ValueType
ARF 2 180 3.95e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128682
Predicted Effect probably benign
Transcript: ENSMUST00000129509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192653
Predicted Effect probably benign
Transcript: ENSMUST00000193836
Predicted Effect probably benign
Transcript: ENSMUST00000193883
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARL5B (ARL8) belongs to a family of proteins that are structurally similar to ADP-ribosylation factors (ARFs; see MIM 103180). ARLs and ARFs are part of the RAS superfamily of regulatory GTPases.[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 T A 17: 42,710,122 T604S probably damaging Het
Ago3 T A 4: 126,355,091 T556S possibly damaging Het
Arap2 T C 5: 62,670,979 I950V possibly damaging Het
Capza3 A G 6: 140,042,538 I288V probably benign Het
Chka G A 19: 3,875,737 probably benign Het
Cnpy4 G T 5: 138,192,591 V159F probably damaging Het
Crb1 T C 1: 139,323,311 I301V probably benign Het
Disp1 T A 1: 183,087,644 I1071F possibly damaging Het
Dlec1 C T 9: 119,143,163 A1417V probably damaging Het
Dlgap1 T A 17: 70,766,043 S686T probably benign Het
Dync1li2 A G 8: 104,423,143 S411P probably damaging Het
Efnb2 T A 8: 8,620,698 S301C probably damaging Het
Enpp4 T C 17: 44,101,807 N279D probably benign Het
Exoc3 A G 13: 74,192,644 V347A probably damaging Het
Ezh1 A G 11: 101,194,908 F641S probably damaging Het
Gcgr T A 11: 120,538,424 probably benign Het
Gm4887 G T 7: 104,821,328 noncoding transcript Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Htt G A 5: 34,849,069 V1441I possibly damaging Het
Lmtk2 A G 5: 144,183,226 M1398V probably benign Het
Lrrc15 T C 16: 30,273,855 N222S probably benign Het
Mctp2 A T 7: 72,259,331 V78E possibly damaging Het
Medag A G 5: 149,422,163 Y103C probably damaging Het
Mphosph9 G A 5: 124,304,203 P361S probably damaging Het
Npffr2 G A 5: 89,568,023 V70M probably damaging Het
Obox3-ps8 A C 17: 36,453,017 noncoding transcript Het
Olfr1222 A G 2: 89,125,362 V123A probably damaging Het
Pdgfra G A 5: 75,183,070 V751I probably benign Het
Phykpl T C 11: 51,585,528 L25P probably damaging Het
Rgl1 A T 1: 152,536,289 I443N probably benign Het
Riok3 AGAAGCGG AG 18: 12,135,941 probably benign Het
Rragd T C 4: 32,996,099 probably null Het
Rtcb A T 10: 85,957,619 M30K probably damaging Het
Rusc2 T A 4: 43,415,533 C280S probably damaging Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Skp2 C A 15: 9,116,860 probably null Het
Slc52a3 T A 2: 152,005,740 I256N possibly damaging Het
Sycp2 A T 2: 178,358,224 D986E probably benign Het
Tas1r1 T C 4: 152,032,157 E340G possibly damaging Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Trhr G A 15: 44,197,224 V47I probably damaging Het
Trpm2 A T 10: 77,933,642 N749K probably damaging Het
Ttc27 T A 17: 74,840,360 W636R probably damaging Het
Ttc30a1 A G 2: 75,980,474 Y422H probably damaging Het
Ttn C A 2: 76,778,347 R17775L probably damaging Het
Vmn2r55 A G 7: 12,668,179 F394S probably benign Het
Zfp52 C A 17: 21,560,197 Y102* probably null Het
Zyx A G 6: 42,350,946 D70G probably damaging Het
Other mutations in Arl5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Arl5b APN 2 15069935 missense probably benign 0.03
IGL02374:Arl5b APN 2 15068192 missense probably damaging 1.00
IGL03213:Arl5b APN 2 15069865 missense probably damaging 1.00
IGL03396:Arl5b APN 2 15075104 missense probably damaging 0.96
R0559:Arl5b UTSW 2 15073187 missense probably damaging 1.00
R0959:Arl5b UTSW 2 15073131 missense probably damaging 1.00
R1160:Arl5b UTSW 2 15069837 missense probably benign 0.36
R1766:Arl5b UTSW 2 15069837 missense probably benign 0.36
R2100:Arl5b UTSW 2 15073195 missense probably benign 0.03
R2403:Arl5b UTSW 2 15075037 missense probably damaging 1.00
R6782:Arl5b UTSW 2 15073182 missense probably damaging 0.98
R7423:Arl5b UTSW 2 15068172 missense probably damaging 1.00
R7898:Arl5b UTSW 2 15075058 missense probably damaging 0.99
R7981:Arl5b UTSW 2 15075058 missense probably damaging 0.99
Z1088:Arl5b UTSW 2 15075021 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TACGTGCTCGCTGATGGAAAG -3'
(R):5'- AGTTGTAGCAAGCAAATTAACAGGC -3'

Sequencing Primer
(F):5'- AAGGCAGTGAGGTTCTGTAGC -3'
(R):5'- CAAGCAAATTAACAGGCTTGAAG -3'
Posted On2015-06-20