Incidental Mutation 'R4272:Ttc30a1'
ID322201
Institutional Source Beutler Lab
Gene Symbol Ttc30a1
Ensembl Gene ENSMUSG00000075271
Gene Nametetratricopeptide repeat domain 30A1
Synonyms
MMRRC Submission 041644-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R4272 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location75978247-75981967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75980474 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 422 (Y422H)
Ref Sequence ENSEMBL: ENSMUSP00000097574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099994] [ENSMUST00000099995]
Predicted Effect probably damaging
Transcript: ENSMUST00000099994
AA Change: Y422H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097574
Gene: ENSMUSG00000075271
AA Change: Y422H

DomainStartEndE-ValueType
TPR 45 78 1.1e-1 SMART
TPR 153 186 2.19e1 SMART
TPR 187 220 6.24e1 SMART
coiled coil region 380 411 N/A INTRINSIC
TPR 423 456 2.24e1 SMART
Blast:TPR 457 491 1e-10 BLAST
low complexity region 514 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099995
SMART Domains Protein: ENSMUSP00000097575
Gene: ENSMUSG00000075272

DomainStartEndE-ValueType
TPR 45 78 1.1e-1 SMART
TPR 153 186 2.77e1 SMART
Blast:TPR 187 224 1e-13 BLAST
coiled coil region 380 405 N/A INTRINSIC
TPR 423 456 2.24e1 SMART
Blast:TPR 457 491 1e-10 BLAST
low complexity region 514 528 N/A INTRINSIC
Meta Mutation Damage Score 0.208 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 T A 17: 42,710,122 T604S probably damaging Het
Ago3 T A 4: 126,355,091 T556S possibly damaging Het
Arap2 T C 5: 62,670,979 I950V possibly damaging Het
Arl5b A G 2: 15,073,179 E105G probably damaging Het
Capza3 A G 6: 140,042,538 I288V probably benign Het
Chka G A 19: 3,875,737 probably benign Het
Cnpy4 G T 5: 138,192,591 V159F probably damaging Het
Crb1 T C 1: 139,323,311 I301V probably benign Het
Disp1 T A 1: 183,087,644 I1071F possibly damaging Het
Dlec1 C T 9: 119,143,163 A1417V probably damaging Het
Dlgap1 T A 17: 70,766,043 S686T probably benign Het
Dync1li2 A G 8: 104,423,143 S411P probably damaging Het
Efnb2 T A 8: 8,620,698 S301C probably damaging Het
Enpp4 T C 17: 44,101,807 N279D probably benign Het
Exoc3 A G 13: 74,192,644 V347A probably damaging Het
Ezh1 A G 11: 101,194,908 F641S probably damaging Het
Gcgr T A 11: 120,538,424 probably benign Het
Gm4887 G T 7: 104,821,328 noncoding transcript Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Htt G A 5: 34,849,069 V1441I possibly damaging Het
Lmtk2 A G 5: 144,183,226 M1398V probably benign Het
Lrrc15 T C 16: 30,273,855 N222S probably benign Het
Mctp2 A T 7: 72,259,331 V78E possibly damaging Het
Medag A G 5: 149,422,163 Y103C probably damaging Het
Mphosph9 G A 5: 124,304,203 P361S probably damaging Het
Npffr2 G A 5: 89,568,023 V70M probably damaging Het
Obox3-ps8 A C 17: 36,453,017 noncoding transcript Het
Olfr1222 A G 2: 89,125,362 V123A probably damaging Het
Pdgfra G A 5: 75,183,070 V751I probably benign Het
Phykpl T C 11: 51,585,528 L25P probably damaging Het
Rgl1 A T 1: 152,536,289 I443N probably benign Het
Riok3 AGAAGCGG AG 18: 12,135,941 probably benign Het
Rragd T C 4: 32,996,099 probably null Het
Rtcb A T 10: 85,957,619 M30K probably damaging Het
Rusc2 T A 4: 43,415,533 C280S probably damaging Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Skp2 C A 15: 9,116,860 probably null Het
Slc52a3 T A 2: 152,005,740 I256N possibly damaging Het
Sycp2 A T 2: 178,358,224 D986E probably benign Het
Tas1r1 T C 4: 152,032,157 E340G possibly damaging Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Trhr G A 15: 44,197,224 V47I probably damaging Het
Trpm2 A T 10: 77,933,642 N749K probably damaging Het
Ttc27 T A 17: 74,840,360 W636R probably damaging Het
Ttn C A 2: 76,778,347 R17775L probably damaging Het
Vmn2r55 A G 7: 12,668,179 F394S probably benign Het
Zfp52 C A 17: 21,560,197 Y102* probably null Het
Zyx A G 6: 42,350,946 D70G probably damaging Het
Other mutations in Ttc30a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Ttc30a1 APN 2 75981741 unclassified probably benign
IGL01140:Ttc30a1 APN 2 75979915 missense probably benign 0.01
IGL01527:Ttc30a1 APN 2 75980516 missense probably benign
IGL01690:Ttc30a1 APN 2 75979933 missense probably benign
IGL01916:Ttc30a1 APN 2 75980879 missense probably damaging 0.98
IGL02342:Ttc30a1 APN 2 75980632 missense probably benign 0.45
IGL02728:Ttc30a1 APN 2 75980849 missense probably benign 0.01
IGL03171:Ttc30a1 APN 2 75980507 missense probably benign 0.00
PIT4677001:Ttc30a1 UTSW 2 75979769 missense possibly damaging 0.60
R0781:Ttc30a1 UTSW 2 75979976 missense probably damaging 0.98
R1110:Ttc30a1 UTSW 2 75979976 missense probably damaging 0.98
R1185:Ttc30a1 UTSW 2 75980352 missense probably damaging 1.00
R1185:Ttc30a1 UTSW 2 75980352 missense probably damaging 1.00
R1750:Ttc30a1 UTSW 2 75980255 missense probably benign 0.21
R2016:Ttc30a1 UTSW 2 75981457 missense probably benign 0.42
R2017:Ttc30a1 UTSW 2 75981457 missense probably benign 0.42
R2020:Ttc30a1 UTSW 2 75980935 missense probably benign
R3606:Ttc30a1 UTSW 2 75981277 missense probably benign 0.06
R4600:Ttc30a1 UTSW 2 75980633 missense probably benign 0.26
R4894:Ttc30a1 UTSW 2 75979744 makesense probably null
R4996:Ttc30a1 UTSW 2 75979922 missense probably benign
R5217:Ttc30a1 UTSW 2 75980803 missense probably damaging 1.00
R5721:Ttc30a1 UTSW 2 75981371 missense probably damaging 0.99
R6002:Ttc30a1 UTSW 2 75980777 missense possibly damaging 0.59
R6006:Ttc30a1 UTSW 2 75981488 missense probably benign 0.08
R7316:Ttc30a1 UTSW 2 75980857 missense probably damaging 1.00
R7391:Ttc30a1 UTSW 2 75980015 missense probably benign 0.05
R7494:Ttc30a1 UTSW 2 75979898 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCTCATAGAAACCAATGGC -3'
(R):5'- GCCCACTTAACTTACAAGTTCC -3'

Sequencing Primer
(F):5'- GCTCATAGAAACCAATGGCCTCTTTG -3'
(R):5'- GGATGCCATGATCACTTGCCAG -3'
Posted On2015-06-20