Incidental Mutation 'R4272:Slc52a3'
ID322204
Institutional Source Beutler Lab
Gene Symbol Slc52a3
Ensembl Gene ENSMUSG00000027463
Gene Namesolute carrier protein family 52, member 3
Synonyms
MMRRC Submission 041644-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4272 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location151996511-152009258 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152005740 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 256 (I256N)
Ref Sequence ENSEMBL: ENSMUSP00000105487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073228] [ENSMUST00000109858] [ENSMUST00000109859] [ENSMUST00000109861]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073228
AA Change: I256N

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072961
Gene: ENSMUSG00000027463
AA Change: I256N

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 106 128 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 210 232 N/A INTRINSIC
Pfam:DUF1011 285 386 7.6e-47 PFAM
transmembrane domain 390 412 N/A INTRINSIC
transmembrane domain 419 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109858
SMART Domains Protein: ENSMUSP00000105484
Gene: ENSMUSG00000027463

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 106 128 N/A INTRINSIC
transmembrane domain 135 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109859
SMART Domains Protein: ENSMUSP00000105485
Gene: ENSMUSG00000027463

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 106 128 N/A INTRINSIC
transmembrane domain 135 157 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109861
AA Change: I256N

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105487
Gene: ENSMUSG00000027463
AA Change: I256N

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 106 128 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 210 232 N/A INTRINSIC
Pfam:DUF1011 288 386 1.1e-42 PFAM
transmembrane domain 390 412 N/A INTRINSIC
transmembrane domain 419 441 N/A INTRINSIC
Meta Mutation Damage Score 0.1133 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a riboflavin transporter protein that is strongly expressed in the intestine and likely plays a role in intestinal absorption of riboflavin. The protein is predicted to have eleven transmembrane domains and a cell surface localization signal in the C-terminus. Mutations at this locus have been associated with Brown-Vialetto-Van Laere syndrome and Fazio-Londe disease. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal placental riboflavin transport and sudden neonatal death associated with hyperlipidemia and hypoglycemia due to riboflavin deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 T A 17: 42,710,122 T604S probably damaging Het
Ago3 T A 4: 126,355,091 T556S possibly damaging Het
Arap2 T C 5: 62,670,979 I950V possibly damaging Het
Arl5b A G 2: 15,073,179 E105G probably damaging Het
Capza3 A G 6: 140,042,538 I288V probably benign Het
Chka G A 19: 3,875,737 probably benign Het
Cnpy4 G T 5: 138,192,591 V159F probably damaging Het
Crb1 T C 1: 139,323,311 I301V probably benign Het
Disp1 T A 1: 183,087,644 I1071F possibly damaging Het
Dlec1 C T 9: 119,143,163 A1417V probably damaging Het
Dlgap1 T A 17: 70,766,043 S686T probably benign Het
Dync1li2 A G 8: 104,423,143 S411P probably damaging Het
Efnb2 T A 8: 8,620,698 S301C probably damaging Het
Enpp4 T C 17: 44,101,807 N279D probably benign Het
Exoc3 A G 13: 74,192,644 V347A probably damaging Het
Ezh1 A G 11: 101,194,908 F641S probably damaging Het
Gcgr T A 11: 120,538,424 probably benign Het
Gm4887 G T 7: 104,821,328 noncoding transcript Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Htt G A 5: 34,849,069 V1441I possibly damaging Het
Lmtk2 A G 5: 144,183,226 M1398V probably benign Het
Lrrc15 T C 16: 30,273,855 N222S probably benign Het
Mctp2 A T 7: 72,259,331 V78E possibly damaging Het
Medag A G 5: 149,422,163 Y103C probably damaging Het
Mphosph9 G A 5: 124,304,203 P361S probably damaging Het
Npffr2 G A 5: 89,568,023 V70M probably damaging Het
Obox3-ps8 A C 17: 36,453,017 noncoding transcript Het
Olfr1222 A G 2: 89,125,362 V123A probably damaging Het
Pdgfra G A 5: 75,183,070 V751I probably benign Het
Phykpl T C 11: 51,585,528 L25P probably damaging Het
Rgl1 A T 1: 152,536,289 I443N probably benign Het
Riok3 AGAAGCGG AG 18: 12,135,941 probably benign Het
Rragd T C 4: 32,996,099 probably null Het
Rtcb A T 10: 85,957,619 M30K probably damaging Het
Rusc2 T A 4: 43,415,533 C280S probably damaging Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Skp2 C A 15: 9,116,860 probably null Het
Sycp2 A T 2: 178,358,224 D986E probably benign Het
Tas1r1 T C 4: 152,032,157 E340G possibly damaging Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Trhr G A 15: 44,197,224 V47I probably damaging Het
Trpm2 A T 10: 77,933,642 N749K probably damaging Het
Ttc27 T A 17: 74,840,360 W636R probably damaging Het
Ttc30a1 A G 2: 75,980,474 Y422H probably damaging Het
Ttn C A 2: 76,778,347 R17775L probably damaging Het
Vmn2r55 A G 7: 12,668,179 F394S probably benign Het
Zfp52 C A 17: 21,560,197 Y102* probably null Het
Zyx A G 6: 42,350,946 D70G probably damaging Het
Other mutations in Slc52a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Slc52a3 APN 2 152007602 missense probably benign 0.41
IGL01511:Slc52a3 APN 2 152004644 missense probably benign 0.00
IGL02058:Slc52a3 APN 2 152005891 missense probably damaging 1.00
IGL02271:Slc52a3 APN 2 152005528 splice site probably benign
R0238:Slc52a3 UTSW 2 152008156 makesense probably null
R0238:Slc52a3 UTSW 2 152008156 makesense probably null
R0239:Slc52a3 UTSW 2 152008156 makesense probably null
R0239:Slc52a3 UTSW 2 152008156 makesense probably null
R0352:Slc52a3 UTSW 2 152007513 nonsense probably null
R3727:Slc52a3 UTSW 2 152005781 missense probably benign 0.00
R4273:Slc52a3 UTSW 2 152005740 missense possibly damaging 0.87
R6267:Slc52a3 UTSW 2 152007609 splice site probably null
R7265:Slc52a3 UTSW 2 152004416 missense possibly damaging 0.78
R7409:Slc52a3 UTSW 2 152004166 missense probably damaging 1.00
R7634:Slc52a3 UTSW 2 152004614 missense possibly damaging 0.49
R8697:Slc52a3 UTSW 2 152004476 missense probably damaging 1.00
R8822:Slc52a3 UTSW 2 152004593 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAACCTTAGCCCTTCCCTG -3'
(R):5'- TGATCCCCACTAGAGTTCCC -3'

Sequencing Primer
(F):5'- CCCAGCTGGCACCAGGAG -3'
(R):5'- ACTAGAGTTCCCTGGGTCG -3'
Posted On2015-06-20