Mutagenetix > Incidental Mutations

Incidental Mutation 'R4272:Mphosph9'

322216

Institutional Source

Beutler Lab

Gene Symbol

Mphosph9

Ensembl Gene

ENSMUSG00000038126

Gene Name

M-phase phosphoprotein 9

Synonyms

MPP-9, MPP9, B930097C17Rik, 9630025B04Rik, 4930548D04Rik

MMRRC Submission

041644-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4272 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124250959-124327972 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 124304203 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 361 (P361S)

Ref Sequence

ENSEMBL: ENSMUSP00000031344 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031344] [ENSMUST00000130502] [ENSMUST00000141203] [ENSMUST00000147737] [ENSMUST00000184951]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000031344
AA Change: P361S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000031344
Gene: ENSMUSG00000038126
AA Change: P361S

Domain	Start	End	E-Value	Type
low complexity region	102	119	N/A	INTRINSIC
low complexity region	128	140	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
coiled coil region	574	736	N/A	INTRINSIC
low complexity region	879	898	N/A	INTRINSIC
low complexity region	957	971	N/A	INTRINSIC
coiled coil region	1040	1105	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130502

SMART Domains

Protein: ENSMUSP00000120827
Gene: ENSMUSG00000038126

Domain	Start	End	E-Value	Type
low complexity region	47	74	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141203

Predicted Effect

probably benign
Transcript: ENSMUST00000147737

Predicted Effect

probably benign
Transcript: ENSMUST00000184951
AA Change: P391S

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000138982
Gene: ENSMUSG00000038126
AA Change: P391S

Domain	Start	End	E-Value	Type
coiled coil region	102	130	N/A	INTRINSIC
low complexity region	132	149	N/A	INTRINSIC
low complexity region	158	170	N/A	INTRINSIC
low complexity region	444	458	N/A	INTRINSIC
coiled coil region	604	766	N/A	INTRINSIC
low complexity region	909	928	N/A	INTRINSIC
low complexity region	987	1001	N/A	INTRINSIC
coiled coil region	1070	1135	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200448

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

98% (52/53)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrf2	T	A	17: 42,710,122	T604S	probably damaging	Het
Ago3	T	A	4: 126,355,091	T556S	possibly damaging	Het
Arap2	T	C	5: 62,670,979	I950V	possibly damaging	Het
Arl5b	A	G	2: 15,073,179	E105G	probably damaging	Het
Capza3	A	G	6: 140,042,538	I288V	probably benign	Het
Chka	G	A	19: 3,875,737		probably benign	Het
Cnpy4	G	T	5: 138,192,591	V159F	probably damaging	Het
Crb1	T	C	1: 139,323,311	I301V	probably benign	Het
Disp1	T	A	1: 183,087,644	I1071F	possibly damaging	Het
Dlec1	C	T	9: 119,143,163	A1417V	probably damaging	Het
Dlgap1	T	A	17: 70,766,043	S686T	probably benign	Het
Dync1li2	A	G	8: 104,423,143	S411P	probably damaging	Het
Efnb2	T	A	8: 8,620,698	S301C	probably damaging	Het
Enpp4	T	C	17: 44,101,807	N279D	probably benign	Het
Exoc3	A	G	13: 74,192,644	V347A	probably damaging	Het
Ezh1	A	G	11: 101,194,908	F641S	probably damaging	Het
Gcgr	T	A	11: 120,538,424		probably benign	Het
Gm4887	G	T	7: 104,821,328		noncoding transcript	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Htt	G	A	5: 34,849,069	V1441I	possibly damaging	Het
Lmtk2	A	G	5: 144,183,226	M1398V	probably benign	Het
Lrrc15	T	C	16: 30,273,855	N222S	probably benign	Het
Mctp2	A	T	7: 72,259,331	V78E	possibly damaging	Het
Medag	A	G	5: 149,422,163	Y103C	probably damaging	Het
Npffr2	G	A	5: 89,568,023	V70M	probably damaging	Het
Obox3-ps8	A	C	17: 36,453,017		noncoding transcript	Het
Olfr1222	A	G	2: 89,125,362	V123A	probably damaging	Het
Pdgfra	G	A	5: 75,183,070	V751I	probably benign	Het
Phykpl	T	C	11: 51,585,528	L25P	probably damaging	Het
Rgl1	A	T	1: 152,536,289	I443N	probably benign	Het
Riok3	AGAAGCGG	AG	18: 12,135,941		probably benign	Het
Rragd	T	C	4: 32,996,099		probably null	Het
Rtcb	A	T	10: 85,957,619	M30K	probably damaging	Het
Rusc2	T	A	4: 43,415,533	C280S	probably damaging	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Skp2	C	A	15: 9,116,860		probably null	Het
Slc52a3	T	A	2: 152,005,740	I256N	possibly damaging	Het
Sycp2	A	T	2: 178,358,224	D986E	probably benign	Het
Tas1r1	T	C	4: 152,032,157	E340G	possibly damaging	Het
Tnpo1	GCACCTCTGCTTCCTC	GCACCTCTGCTTCCTCACCTCTGCTTCCTC	13: 98,867,129		probably null	Het
Trhr	G	A	15: 44,197,224	V47I	probably damaging	Het
Trpm2	A	T	10: 77,933,642	N749K	probably damaging	Het
Ttc27	T	A	17: 74,840,360	W636R	probably damaging	Het
Ttc30a1	A	G	2: 75,980,474	Y422H	probably damaging	Het
Ttn	C	A	2: 76,778,347	R17775L	probably damaging	Het
Vmn2r55	A	G	7: 12,668,179	F394S	probably benign	Het
Zfp52	C	A	17: 21,560,197	Y102*	probably null	Het
Zyx	A	G	6: 42,350,946	D70G	probably damaging	Het

Other mutations in Mphosph9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Mphosph9	APN	5	124262021	missense	probably damaging	1.00
IGL01527:Mphosph9	APN	5	124283624	splice site	probably benign
IGL01784:Mphosph9	APN	5	124265310	splice site	probably benign
IGL01958:Mphosph9	APN	5	124324990	utr 5 prime	probably benign
IGL02020:Mphosph9	APN	5	124258950	missense	probably damaging	0.99
IGL02190:Mphosph9	APN	5	124265425	missense	possibly damaging	0.92
IGL02261:Mphosph9	APN	5	124260087	missense	probably damaging	1.00
IGL02569:Mphosph9	APN	5	124297571	nonsense	probably null
IGL02640:Mphosph9	APN	5	124315500	missense	possibly damaging	0.66
IGL02702:Mphosph9	APN	5	124259989	missense	probably damaging	1.00
IGL02793:Mphosph9	APN	5	124283737	critical splice acceptor site	probably null
IGL02813:Mphosph9	APN	5	124315628	missense	probably benign	0.37
IGL02875:Mphosph9	APN	5	124283737	critical splice acceptor site	probably null
IGL03149:Mphosph9	APN	5	124263011	missense	probably damaging	1.00
PIT4445001:Mphosph9	UTSW	5	124298790	missense	possibly damaging	0.82
R0304:Mphosph9	UTSW	5	124298829	missense	probably benign	0.01
R0437:Mphosph9	UTSW	5	124315568	missense	probably benign	0.27
R0483:Mphosph9	UTSW	5	124306970	nonsense	probably null
R0811:Mphosph9	UTSW	5	124298759	missense	probably damaging	1.00
R0812:Mphosph9	UTSW	5	124298759	missense	probably damaging	1.00
R0942:Mphosph9	UTSW	5	124262037	nonsense	probably null
R1175:Mphosph9	UTSW	5	124315676	missense	possibly damaging	0.94
R1372:Mphosph9	UTSW	5	124283745	splice site	probably null
R1442:Mphosph9	UTSW	5	124265398	missense	possibly damaging	0.62
R1533:Mphosph9	UTSW	5	124267141	missense	probably damaging	1.00
R1959:Mphosph9	UTSW	5	124315701	missense	possibly damaging	0.92
R2036:Mphosph9	UTSW	5	124304211	missense	probably damaging	0.97
R2256:Mphosph9	UTSW	5	124283659	missense	probably benign	0.00
R2919:Mphosph9	UTSW	5	124261006	missense	probably benign	0.22
R2920:Mphosph9	UTSW	5	124261006	missense	probably benign	0.22
R4064:Mphosph9	UTSW	5	124290917	missense	probably damaging	1.00
R4430:Mphosph9	UTSW	5	124265446	missense	possibly damaging	0.83
R4883:Mphosph9	UTSW	5	124299045	missense	probably damaging	1.00
R4992:Mphosph9	UTSW	5	124304190	missense	probably damaging	1.00
R5815:Mphosph9	UTSW	5	124315418	missense	probably damaging	1.00
R5993:Mphosph9	UTSW	5	124316098	missense	probably benign	0.40
R6102:Mphosph9	UTSW	5	124297709	missense	possibly damaging	0.86
R6295:Mphosph9	UTSW	5	124320915	missense	possibly damaging	0.46
R6320:Mphosph9	UTSW	5	124324961	missense	probably damaging	0.99
R6628:Mphosph9	UTSW	5	124298762	missense	probably damaging	0.98
R6692:Mphosph9	UTSW	5	124260116	missense	probably damaging	1.00
R6705:Mphosph9	UTSW	5	124290964	missense	possibly damaging	0.83
R6747:Mphosph9	UTSW	5	124297699	missense	possibly damaging	0.93
R6787:Mphosph9	UTSW	5	124261027	missense	probably damaging	0.99
R6850:Mphosph9	UTSW	5	124260956	missense	probably damaging	1.00
R6956:Mphosph9	UTSW	5	124297558	missense	probably damaging	1.00
R7075:Mphosph9	UTSW	5	124320859	missense	probably damaging	0.99
R7604:Mphosph9	UTSW	5	124316117	missense	probably benign	0.01
R7789:Mphosph9	UTSW	5	124315587	missense	probably damaging	1.00
R7808:Mphosph9	UTSW	5	124260946	missense	probably damaging	0.99
R7823:Mphosph9	UTSW	5	124304256	missense	probably damaging	0.99
R7891:Mphosph9	UTSW	5	124290904	missense	probably damaging	1.00
R8210:Mphosph9	UTSW	5	124267111	missense	probably damaging	1.00
R8256:Mphosph9	UTSW	5	124255106	missense	probably damaging	1.00
R8385:Mphosph9	UTSW	5	124312722	missense	probably benign	0.19
R8438:Mphosph9	UTSW	5	124292392	missense	probably benign	0.19
R8692:Mphosph9	UTSW	5	124312812	missense	probably damaging	0.99
R8790:Mphosph9	UTSW	5	124315673	missense	probably damaging	1.00
R8818:Mphosph9	UTSW	5	124324964	nonsense	probably null
R8847:Mphosph9	UTSW	5	124316146	missense	possibly damaging	0.91
R9018:Mphosph9	UTSW	5	124298650	missense	probably benign	0.12
R9208:Mphosph9	UTSW	5	124312791	missense	probably damaging	0.97
R9221:Mphosph9	UTSW	5	124265364	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- AGAAAGGCAGCCTGACTCTC -3'
(R):5'- GTGTAAGCCAAATAAACCCTTTCCTC -3'

Sequencing Primer
(F):5'- GCCTGACTCTCAAACCTAAGCTTC -3'
(R):5'- CATGTTTGTGCAGGAATAGAAACCC -3'

Posted On

2015-06-20