Incidental Mutation 'R4272:Lmtk2'
ID322218
Institutional Source Beutler Lab
Gene Symbol Lmtk2
Ensembl Gene ENSMUSG00000038970
Gene Namelemur tyrosine kinase 2
SynonymsAATYK2, A330101P12Rik, KPI2, cprk, KPI-2, 2900041G10Rik, BREK
MMRRC Submission 041644-MU
Accession Numbers

Genbank: NM_001081109; MGI: 3036247

Is this an essential gene? Possibly non essential (E-score: 0.446) question?
Stock #R4272 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location144100436-144188204 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144183226 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1398 (M1398V)
Ref Sequence ENSEMBL: ENSMUSP00000048238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041804]
Predicted Effect probably benign
Transcript: ENSMUST00000041804
AA Change: M1398V

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000048238
Gene: ENSMUSG00000038970
AA Change: M1398V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 42 61 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
STYKc 136 406 3.4e-39 SMART
low complexity region 924 953 N/A INTRINSIC
low complexity region 1019 1035 N/A INTRINSIC
low complexity region 1104 1117 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1354 1367 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase superfamily and the protein tyrosine kinase family. It contains N-terminal transmembrane helices and a long C-terminal cytoplasmic tail with serine/threonine/tyrosine kinase activity. This protein interacts with several other proteins, such as Inhibitor-2 (Inh2), protein phosphatase-1 (PP1C), p35, and myosin VI. It phosporylates other proteins, and is itself also phosporylated when interacting with cyclin-dependent kinase 5 (cdk5)/p35 complex. This protein involves in nerve growth factor (NGF)-TrkA signalling, and also plays a critical role in endosomal membrane trafficking. Mouse studies suggested an essential role of this protein in spermatogenesis. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation in this gene display partial prenatal lethality, male infertility, and azoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(31) : Targeted, knock-out(1) Gene trapped(30)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 T A 17: 42,710,122 T604S probably damaging Het
Ago3 T A 4: 126,355,091 T556S possibly damaging Het
Arap2 T C 5: 62,670,979 I950V possibly damaging Het
Arl5b A G 2: 15,073,179 E105G probably damaging Het
Capza3 A G 6: 140,042,538 I288V probably benign Het
Chka G A 19: 3,875,737 probably benign Het
Cnpy4 G T 5: 138,192,591 V159F probably damaging Het
Crb1 T C 1: 139,323,311 I301V probably benign Het
Disp1 T A 1: 183,087,644 I1071F possibly damaging Het
Dlec1 C T 9: 119,143,163 A1417V probably damaging Het
Dlgap1 T A 17: 70,766,043 S686T probably benign Het
Dync1li2 A G 8: 104,423,143 S411P probably damaging Het
Efnb2 T A 8: 8,620,698 S301C probably damaging Het
Enpp4 T C 17: 44,101,807 N279D probably benign Het
Exoc3 A G 13: 74,192,644 V347A probably damaging Het
Ezh1 A G 11: 101,194,908 F641S probably damaging Het
Gcgr T A 11: 120,538,424 probably benign Het
Gm4887 G T 7: 104,821,328 noncoding transcript Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Htt G A 5: 34,849,069 V1441I possibly damaging Het
Lrrc15 T C 16: 30,273,855 N222S probably benign Het
Mctp2 A T 7: 72,259,331 V78E possibly damaging Het
Medag A G 5: 149,422,163 Y103C probably damaging Het
Mphosph9 G A 5: 124,304,203 P361S probably damaging Het
Npffr2 G A 5: 89,568,023 V70M probably damaging Het
Obox3-ps8 A C 17: 36,453,017 noncoding transcript Het
Olfr1222 A G 2: 89,125,362 V123A probably damaging Het
Pdgfra G A 5: 75,183,070 V751I probably benign Het
Phykpl T C 11: 51,585,528 L25P probably damaging Het
Rgl1 A T 1: 152,536,289 I443N probably benign Het
Riok3 AGAAGCGG AG 18: 12,135,941 probably benign Het
Rragd T C 4: 32,996,099 probably null Het
Rtcb A T 10: 85,957,619 M30K probably damaging Het
Rusc2 T A 4: 43,415,533 C280S probably damaging Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Skp2 C A 15: 9,116,860 probably null Het
Slc52a3 T A 2: 152,005,740 I256N possibly damaging Het
Sycp2 A T 2: 178,358,224 D986E probably benign Het
Tas1r1 T C 4: 152,032,157 E340G possibly damaging Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Trhr G A 15: 44,197,224 V47I probably damaging Het
Trpm2 A T 10: 77,933,642 N749K probably damaging Het
Ttc27 T A 17: 74,840,360 W636R probably damaging Het
Ttc30a1 A G 2: 75,980,474 Y422H probably damaging Het
Ttn C A 2: 76,778,347 R17775L probably damaging Het
Vmn2r55 A G 7: 12,668,179 F394S probably benign Het
Zfp52 C A 17: 21,560,197 Y102* probably null Het
Zyx A G 6: 42,350,946 D70G probably damaging Het
Other mutations in Lmtk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Lmtk2 APN 5 144134155 missense probably damaging 1.00
IGL00496:Lmtk2 APN 5 144174694 missense probably benign
IGL00848:Lmtk2 APN 5 144176398 missense probably benign
IGL01450:Lmtk2 APN 5 144174702 missense probably benign 0.03
IGL01833:Lmtk2 APN 5 144175935 nonsense probably null
IGL01967:Lmtk2 APN 5 144182779 missense probably benign
IGL01998:Lmtk2 APN 5 144176065 missense probably damaging 1.00
IGL02106:Lmtk2 APN 5 144175951 missense probably benign 0.03
IGL02147:Lmtk2 APN 5 144156936 missense possibly damaging 0.78
IGL02581:Lmtk2 APN 5 144148348 missense probably damaging 1.00
madagascar UTSW 5 144174919 missense probably benign 0.02
A4554:Lmtk2 UTSW 5 144166317 missense possibly damaging 0.82
R0039:Lmtk2 UTSW 5 144166387 missense probably damaging 1.00
R0039:Lmtk2 UTSW 5 144166387 missense probably damaging 1.00
R0108:Lmtk2 UTSW 5 144174285 missense possibly damaging 0.78
R0367:Lmtk2 UTSW 5 144174285 missense possibly damaging 0.78
R0515:Lmtk2 UTSW 5 144174991 missense possibly damaging 0.77
R1434:Lmtk2 UTSW 5 144174589 missense probably damaging 1.00
R1617:Lmtk2 UTSW 5 144173862 missense probably damaging 1.00
R1760:Lmtk2 UTSW 5 144174175 missense probably damaging 0.99
R1785:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R1786:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R1907:Lmtk2 UTSW 5 144175110 missense probably benign 0.00
R2130:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2131:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2132:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2133:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2140:Lmtk2 UTSW 5 144147615 missense probably damaging 1.00
R2141:Lmtk2 UTSW 5 144147615 missense probably damaging 1.00
R2210:Lmtk2 UTSW 5 144147609 missense probably damaging 1.00
R2289:Lmtk2 UTSW 5 144176106 missense possibly damaging 0.80
R2312:Lmtk2 UTSW 5 144173626 missense probably damaging 1.00
R2352:Lmtk2 UTSW 5 144173911 missense probably benign 0.05
R3870:Lmtk2 UTSW 5 144166427 splice site probably benign
R4011:Lmtk2 UTSW 5 144175879 missense probably benign 0.01
R4361:Lmtk2 UTSW 5 144147664 missense probably damaging 1.00
R4580:Lmtk2 UTSW 5 144174781 missense possibly damaging 0.56
R4621:Lmtk2 UTSW 5 144174934 missense probably benign 0.02
R4981:Lmtk2 UTSW 5 144176447 missense probably damaging 1.00
R5818:Lmtk2 UTSW 5 144156900 missense probably benign 0.07
R5984:Lmtk2 UTSW 5 144174838 missense probably benign
R6083:Lmtk2 UTSW 5 144182756 missense probably damaging 1.00
R6180:Lmtk2 UTSW 5 144175342 missense probably damaging 1.00
R6411:Lmtk2 UTSW 5 144174586 missense probably damaging 0.99
R6544:Lmtk2 UTSW 5 144173806 missense possibly damaging 0.68
R6628:Lmtk2 UTSW 5 144174685 missense probably benign 0.03
R6698:Lmtk2 UTSW 5 144174919 missense probably benign 0.02
R6742:Lmtk2 UTSW 5 144148357 missense probably damaging 1.00
R6763:Lmtk2 UTSW 5 144173797 missense probably damaging 1.00
R7286:Lmtk2 UTSW 5 144174360 nonsense probably null
R7390:Lmtk2 UTSW 5 144129443 missense possibly damaging 0.79
R7594:Lmtk2 UTSW 5 144173746 missense probably damaging 1.00
R7660:Lmtk2 UTSW 5 144148340 missense probably damaging 1.00
R7785:Lmtk2 UTSW 5 144174753 missense probably benign 0.00
X0024:Lmtk2 UTSW 5 144174250 missense probably benign 0.22
Z1088:Lmtk2 UTSW 5 144182851 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CCATGGTCTACAGTTGGAAAGAAAG -3'
(R):5'- GATGAAAGCCCTCATGCCTC -3'

Sequencing Primer
(F):5'- GGAGCGCCGCGTGTTTAG -3'
(R):5'- ACATGCAGGGCTCCTCTCAC -3'
Posted On2015-06-20