Incidental Mutation 'R4272:Vmn2r55'
ID322221
Institutional Source Beutler Lab
Gene Symbol Vmn2r55
Ensembl Gene ENSMUSG00000091045
Gene Namevomeronasal 2, receptor 55
Synonyms
MMRRC Submission 041644-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R4272 (G1)
Quality Score106
Status Validated
Chromosome7
Chromosomal Location12651706-12684991 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12668179 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 394 (F394S)
Ref Sequence ENSEMBL: ENSMUSP00000132834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167771] [ENSMUST00000172743]
Predicted Effect probably benign
Transcript: ENSMUST00000167771
AA Change: F394S

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132834
Gene: ENSMUSG00000091045
AA Change: F394S

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 398 6.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172743
AA Change: F394S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000133483
Gene: ENSMUSG00000091045
AA Change: F394S

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.4e-57 PFAM
Pfam:7tm_3 525 762 3.7e-54 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 T A 17: 42,710,122 T604S probably damaging Het
Ago3 T A 4: 126,355,091 T556S possibly damaging Het
Arap2 T C 5: 62,670,979 I950V possibly damaging Het
Arl5b A G 2: 15,073,179 E105G probably damaging Het
Capza3 A G 6: 140,042,538 I288V probably benign Het
Chka G A 19: 3,875,737 probably benign Het
Cnpy4 G T 5: 138,192,591 V159F probably damaging Het
Crb1 T C 1: 139,323,311 I301V probably benign Het
Disp1 T A 1: 183,087,644 I1071F possibly damaging Het
Dlec1 C T 9: 119,143,163 A1417V probably damaging Het
Dlgap1 T A 17: 70,766,043 S686T probably benign Het
Dync1li2 A G 8: 104,423,143 S411P probably damaging Het
Efnb2 T A 8: 8,620,698 S301C probably damaging Het
Enpp4 T C 17: 44,101,807 N279D probably benign Het
Exoc3 A G 13: 74,192,644 V347A probably damaging Het
Ezh1 A G 11: 101,194,908 F641S probably damaging Het
Gcgr T A 11: 120,538,424 probably benign Het
Gm4887 G T 7: 104,821,328 noncoding transcript Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Htt G A 5: 34,849,069 V1441I possibly damaging Het
Lmtk2 A G 5: 144,183,226 M1398V probably benign Het
Lrrc15 T C 16: 30,273,855 N222S probably benign Het
Mctp2 A T 7: 72,259,331 V78E possibly damaging Het
Medag A G 5: 149,422,163 Y103C probably damaging Het
Mphosph9 G A 5: 124,304,203 P361S probably damaging Het
Npffr2 G A 5: 89,568,023 V70M probably damaging Het
Obox3-ps8 A C 17: 36,453,017 noncoding transcript Het
Olfr1222 A G 2: 89,125,362 V123A probably damaging Het
Pdgfra G A 5: 75,183,070 V751I probably benign Het
Phykpl T C 11: 51,585,528 L25P probably damaging Het
Rgl1 A T 1: 152,536,289 I443N probably benign Het
Riok3 AGAAGCGG AG 18: 12,135,941 probably benign Het
Rragd T C 4: 32,996,099 probably null Het
Rtcb A T 10: 85,957,619 M30K probably damaging Het
Rusc2 T A 4: 43,415,533 C280S probably damaging Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Skp2 C A 15: 9,116,860 probably null Het
Slc52a3 T A 2: 152,005,740 I256N possibly damaging Het
Sycp2 A T 2: 178,358,224 D986E probably benign Het
Tas1r1 T C 4: 152,032,157 E340G possibly damaging Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Trhr G A 15: 44,197,224 V47I probably damaging Het
Trpm2 A T 10: 77,933,642 N749K probably damaging Het
Ttc27 T A 17: 74,840,360 W636R probably damaging Het
Ttc30a1 A G 2: 75,980,474 Y422H probably damaging Het
Ttn C A 2: 76,778,347 R17775L probably damaging Het
Zfp52 C A 17: 21,560,197 Y102* probably null Het
Zyx A G 6: 42,350,946 D70G probably damaging Het
Other mutations in Vmn2r55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02684:Vmn2r55 APN 7 12670960 missense probably damaging 1.00
IGL03035:Vmn2r55 APN 7 12670816 missense probably benign 0.01
IGL03115:Vmn2r55 APN 7 12670631 missense probably damaging 1.00
IGL03251:Vmn2r55 APN 7 12671193 splice site probably benign
R0140:Vmn2r55 UTSW 7 12668177 missense possibly damaging 0.58
R0511:Vmn2r55 UTSW 7 12671018 missense possibly damaging 0.88
R1281:Vmn2r55 UTSW 7 12670898 missense probably benign 0.02
R1564:Vmn2r55 UTSW 7 12684751 missense probably damaging 1.00
R1602:Vmn2r55 UTSW 7 12652644 missense probably damaging 1.00
R1785:Vmn2r55 UTSW 7 12668184 missense probably damaging 0.98
R2939:Vmn2r55 UTSW 7 12651905 missense probably damaging 1.00
R2993:Vmn2r55 UTSW 7 12684955 missense probably damaging 1.00
R3151:Vmn2r55 UTSW 7 12670707 missense probably benign 0.06
R4589:Vmn2r55 UTSW 7 12670895 missense probably damaging 0.99
R4624:Vmn2r55 UTSW 7 12670700 missense possibly damaging 0.83
R4965:Vmn2r55 UTSW 7 12670551 missense possibly damaging 0.91
R5294:Vmn2r55 UTSW 7 12651864 missense probably damaging 1.00
R5364:Vmn2r55 UTSW 7 12670903 missense possibly damaging 0.51
R5395:Vmn2r55 UTSW 7 12651947 missense probably damaging 1.00
R5401:Vmn2r55 UTSW 7 12651944 missense probably benign
R5701:Vmn2r55 UTSW 7 12670565 missense probably benign 0.00
R5771:Vmn2r55 UTSW 7 12671032 missense probably damaging 1.00
R5846:Vmn2r55 UTSW 7 12670565 missense probably benign 0.05
R6148:Vmn2r55 UTSW 7 12668142 missense probably benign 0.01
R6159:Vmn2r55 UTSW 7 12651771 missense probably damaging 1.00
R6541:Vmn2r55 UTSW 7 12671012 missense probably damaging 1.00
R7286:Vmn2r55 UTSW 7 12652073 missense probably damaging 0.99
R7483:Vmn2r55 UTSW 7 12670828 missense probably benign 0.00
R8269:Vmn2r55 UTSW 7 12670658 missense possibly damaging 0.86
Z1177:Vmn2r55 UTSW 7 12651837 missense possibly damaging 0.83
Z1177:Vmn2r55 UTSW 7 12671179 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGAATGGCCTACATCCACTTCATG -3'
(R):5'- ATCCCTTCAGACACCATTTGG -3'

Sequencing Primer
(F):5'- GAGGAACCCTGGACTTGAAATTTCC -3'
(R):5'- TTTGGACAAGACACTGAACAGTC -3'
Posted On2015-06-20