Incidental Mutation 'R0001:Col20a1'
ID32223
Institutional Source Beutler Lab
Gene Symbol Col20a1
Ensembl Gene ENSMUSG00000016356
Gene Namecollagen, type XX, alpha 1
Synonyms1700051I12Rik
MMRRC Submission 038297-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0001 (G1)
Quality Score192
Status Validated
Chromosome2
Chromosomal Location180986535-181018363 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 180984412 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029092] [ENSMUST00000108856] [ENSMUST00000108859] [ENSMUST00000108860] [ENSMUST00000108861] [ENSMUST00000108862] [ENSMUST00000149179] [ENSMUST00000184394] [ENSMUST00000185115] [ENSMUST00000228434]
Predicted Effect probably benign
Transcript: ENSMUST00000029092
SMART Domains Protein: ENSMUSP00000029092
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 310 327 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
low complexity region 359 392 N/A INTRINSIC
low complexity region 394 401 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000094214
SMART Domains Protein: ENSMUSP00000091767
Gene: ENSMUSG00000070461

DomainStartEndE-ValueType
low complexity region 107 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108856
SMART Domains Protein: ENSMUSP00000104484
Gene: ENSMUSG00000016356

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
Pfam:Collagen 1067 1125 3.8e-9 PFAM
Pfam:Collagen 1122 1174 7.4e-9 PFAM
Pfam:Collagen 1165 1223 3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108859
SMART Domains Protein: ENSMUSP00000104487
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 288 305 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
low complexity region 337 370 N/A INTRINSIC
low complexity region 372 379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108860
SMART Domains Protein: ENSMUSP00000104488
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 288 305 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
low complexity region 337 370 N/A INTRINSIC
low complexity region 372 379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108861
SMART Domains Protein: ENSMUSP00000104489
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 290 307 N/A INTRINSIC
low complexity region 314 327 N/A INTRINSIC
low complexity region 339 372 N/A INTRINSIC
low complexity region 374 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108862
SMART Domains Protein: ENSMUSP00000104490
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 290 307 N/A INTRINSIC
low complexity region 314 327 N/A INTRINSIC
low complexity region 339 372 N/A INTRINSIC
low complexity region 374 381 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148908
Predicted Effect probably benign
Transcript: ENSMUST00000149179
SMART Domains Protein: ENSMUSP00000115291
Gene: ENSMUSG00000016356

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
low complexity region 1069 1106 N/A INTRINSIC
low complexity region 1108 1121 N/A INTRINSIC
low complexity region 1136 1155 N/A INTRINSIC
Blast:TSPN 1156 1202 2e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184394
SMART Domains Protein: ENSMUSP00000138843
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 298 315 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 347 380 N/A INTRINSIC
low complexity region 382 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185115
SMART Domains Protein: ENSMUSP00000139222
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 320 337 N/A INTRINSIC
low complexity region 344 357 N/A INTRINSIC
low complexity region 369 402 N/A INTRINSIC
low complexity region 404 411 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189441
Predicted Effect probably benign
Transcript: ENSMUST00000228434
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (76/77)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik G A 19: 58,789,171 A61V probably damaging Het
2900092C05Rik T A 7: 12,554,607 probably benign Het
A4galt A G 15: 83,228,289 F98L probably benign Het
Abca4 T G 3: 122,081,011 probably benign Het
Acacb C T 5: 114,204,833 probably benign Het
Agbl1 A T 7: 76,419,863 H367L probably damaging Het
Apoa4 C A 9: 46,242,892 Q264K probably benign Het
Camsap2 A T 1: 136,282,888 probably benign Het
Cdan1 C A 2: 120,723,751 R939L probably benign Het
Ceacam18 G A 7: 43,636,876 V58I possibly damaging Het
Ciita A T 16: 10,514,433 probably benign Het
Clk4 T A 11: 51,268,765 probably benign Het
Cntnap2 T C 6: 46,530,171 D215G probably benign Het
Col11a2 T C 17: 34,061,612 S1218P probably benign Het
Ctsb A G 14: 63,135,622 E76G probably benign Het
Ctu2 T C 8: 122,478,920 C161R probably benign Het
Dhx29 T C 13: 112,964,556 L1211P probably damaging Het
Dhx9 G T 1: 153,462,636 T759K probably damaging Het
Dmxl1 T C 18: 49,888,897 probably benign Het
Dpysl3 C T 18: 43,358,375 E226K possibly damaging Het
Eif2d A T 1: 131,168,127 K453* probably null Het
Epha7 T C 4: 28,961,279 probably benign Het
Fam160b1 T A 19: 57,381,756 H477Q probably benign Het
Fat3 T C 9: 16,377,873 D118G probably damaging Het
Foxn4 T A 5: 114,260,870 Q159L probably damaging Het
Frs2 G T 10: 117,074,876 H194N possibly damaging Het
Fut8 A T 12: 77,475,315 *576L probably null Het
Galns T C 8: 122,595,883 probably benign Het
Gamt G A 10: 80,259,061 probably benign Het
Gpn1 T A 5: 31,495,617 probably benign Het
Ipcef1 G T 10: 6,900,600 H330Q probably damaging Het
Itga4 A C 2: 79,326,587 Y1024S probably damaging Het
Jak2 A G 19: 29,282,387 I229V probably benign Het
Katnal1 A G 5: 148,921,275 S42P probably damaging Het
Kcnu1 A T 8: 25,859,270 D142V probably damaging Het
Lig3 C T 11: 82,790,591 R470W probably damaging Het
Mgat4c A G 10: 102,388,956 S344G probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mipol1 C T 12: 57,460,839 probably benign Het
Mki67 C T 7: 135,699,172 V1378M probably damaging Het
Mki67 T A 7: 135,701,019 D762V probably damaging Het
Mmp9 A G 2: 164,948,383 T43A probably benign Het
Muc6 T C 7: 141,641,574 T1316A possibly damaging Het
Naip5 A G 13: 100,214,650 probably null Het
Naip5 C A 13: 100,223,114 S538I probably benign Het
Nek3 A T 8: 22,158,612 probably benign Het
Nlrp1b A G 11: 71,161,759 S948P probably damaging Het
Nyap2 A T 1: 81,192,107 H193L probably benign Het
Olfr1413 A G 1: 92,573,461 K97E possibly damaging Het
Olfr648 T A 7: 104,179,473 K312* probably null Het
Patl2 G A 2: 122,125,710 probably benign Het
Pcdhb11 A T 18: 37,423,989 R791W probably benign Het
Pkd1l3 C A 8: 109,628,633 probably benign Het
Pkn2 A T 3: 142,828,988 V73D probably benign Het
Pknox1 A T 17: 31,599,636 H281L probably damaging Het
Polr3a A G 14: 24,452,189 probably benign Het
Prss38 A G 11: 59,373,180 probably benign Het
Rad54l2 A G 9: 106,708,217 F783S probably damaging Het
Rbm5 T C 9: 107,742,424 R125G probably damaging Het
Rnpep A G 1: 135,272,485 probably benign Het
Slc1a5 T A 7: 16,793,637 probably null Het
Slc22a4 G A 11: 54,028,003 probably benign Het
Spink12 T C 18: 44,107,696 C50R probably damaging Het
Svep1 G A 4: 58,066,460 T3208I possibly damaging Het
Tgm5 G T 2: 121,077,646 D16E probably damaging Het
Tpp2 A G 1: 43,971,726 N558D probably benign Het
Trappc9 A T 15: 72,963,662 L507Q probably damaging Het
Trpm3 A T 19: 22,715,331 Q262L possibly damaging Het
Ttn A G 2: 76,776,972 probably benign Het
Ttn G A 2: 76,832,089 probably benign Het
Ubr4 T A 4: 139,451,788 L3316Q probably damaging Het
Uckl1 T A 2: 181,574,655 Y136F probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps39 A G 2: 120,318,053 V870A probably benign Het
Zdhhc25 A G 15: 88,600,909 D149G probably benign Het
Zfp648 C T 1: 154,205,286 T397M probably damaging Het
Zic2 C A 14: 122,478,957 T435K probably damaging Het
Other mutations in Col20a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Col20a1 APN 2 181003479 missense possibly damaging 0.93
IGL00975:Col20a1 APN 2 180992478 missense probably damaging 1.00
IGL01094:Col20a1 APN 2 180999766 missense probably damaging 0.99
IGL01388:Col20a1 APN 2 181003471 missense probably benign 0.24
IGL01472:Col20a1 APN 2 181007832 missense probably benign 0.44
IGL01936:Col20a1 APN 2 181009368 splice site probably benign
IGL02133:Col20a1 APN 2 181007144 missense probably damaging 1.00
IGL02318:Col20a1 APN 2 181007159 missense probably damaging 0.99
IGL02576:Col20a1 APN 2 181013405 nonsense probably null
IGL02822:Col20a1 APN 2 180996807 missense probably damaging 1.00
IGL02898:Col20a1 APN 2 180989112 nonsense probably null
IGL03056:Col20a1 APN 2 180994889 missense probably damaging 1.00
IGL03189:Col20a1 APN 2 181009407 nonsense probably null
IGL03196:Col20a1 APN 2 181007878 splice site probably null
R0200:Col20a1 UTSW 2 181000438 missense probably damaging 1.00
R0384:Col20a1 UTSW 2 180999162 missense probably benign 0.00
R0964:Col20a1 UTSW 2 180984485 unclassified probably benign
R0975:Col20a1 UTSW 2 181006826 missense possibly damaging 0.75
R1359:Col20a1 UTSW 2 180999792 missense probably benign 0.02
R1395:Col20a1 UTSW 2 180998607 missense probably damaging 0.99
R1470:Col20a1 UTSW 2 180994960 missense probably benign 0.01
R1470:Col20a1 UTSW 2 180994960 missense probably benign 0.01
R1508:Col20a1 UTSW 2 180992577 missense probably damaging 0.98
R1865:Col20a1 UTSW 2 181015813 missense possibly damaging 0.87
R1883:Col20a1 UTSW 2 180992910 missense possibly damaging 0.52
R1884:Col20a1 UTSW 2 180992910 missense possibly damaging 0.52
R1906:Col20a1 UTSW 2 180998697 missense probably benign 0.00
R2020:Col20a1 UTSW 2 181013163 critical splice donor site probably null
R2121:Col20a1 UTSW 2 180996456 missense probably damaging 0.99
R2131:Col20a1 UTSW 2 180992573 missense probably damaging 1.00
R2343:Col20a1 UTSW 2 181001331 missense possibly damaging 0.73
R3153:Col20a1 UTSW 2 181008593 missense probably damaging 1.00
R3430:Col20a1 UTSW 2 181013285 nonsense probably null
R3547:Col20a1 UTSW 2 180994911 missense probably damaging 1.00
R3844:Col20a1 UTSW 2 180992449 missense probably damaging 1.00
R3914:Col20a1 UTSW 2 180998492 missense probably benign 0.00
R4414:Col20a1 UTSW 2 181001250 missense possibly damaging 0.92
R4711:Col20a1 UTSW 2 180992491 missense probably damaging 1.00
R4760:Col20a1 UTSW 2 180984403 unclassified probably benign
R4771:Col20a1 UTSW 2 180989124 missense probably benign 0.17
R4809:Col20a1 UTSW 2 180998661 missense probably damaging 1.00
R4872:Col20a1 UTSW 2 180997363 missense possibly damaging 0.74
R5045:Col20a1 UTSW 2 181006845 missense probably damaging 1.00
R5238:Col20a1 UTSW 2 180998586 missense probably damaging 1.00
R5566:Col20a1 UTSW 2 180986523 unclassified probably null
R6389:Col20a1 UTSW 2 180992583 splice site probably null
R6422:Col20a1 UTSW 2 181014819 missense possibly damaging 0.75
R6924:Col20a1 UTSW 2 180996850 missense probably damaging 1.00
R6982:Col20a1 UTSW 2 180996706 missense probably benign 0.00
R7177:Col20a1 UTSW 2 180994214 nonsense probably null
R7195:Col20a1 UTSW 2 181007231 missense probably damaging 1.00
R7717:Col20a1 UTSW 2 181007615 missense probably damaging 1.00
R7872:Col20a1 UTSW 2 180986578 missense probably benign 0.14
R7955:Col20a1 UTSW 2 180986578 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AGTATCCCCTACTGTCAGGCTGTG -3'
(R):5'- GCTCTCAATGAAGCTCTCGTGATCC -3'

Sequencing Primer
(F):5'- ACATGCCATTGCTAGGTACAG -3'
(R):5'- ATGAAGCTCTCGTGATCCATCTTG -3'
Posted On2013-05-09