Incidental Mutation 'R4272:Exoc3'
ID322232
Institutional Source Beutler Lab
Gene Symbol Exoc3
Ensembl Gene ENSMUSG00000034152
Gene Nameexocyst complex component 3
SynonymsSec6l1, E430013E20Rik, 2810050O03Rik
MMRRC Submission 041644-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R4272 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location74169488-74208732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74192644 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 347 (V347A)
Ref Sequence ENSEMBL: ENSMUSP00000039416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035934] [ENSMUST00000222213]
Predicted Effect probably damaging
Transcript: ENSMUST00000035934
AA Change: V347A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039416
Gene: ENSMUSG00000034152
AA Change: V347A

DomainStartEndE-ValueType
Pfam:Sec6 187 743 1.7e-162 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222213
Meta Mutation Damage Score 0.3039 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 T A 17: 42,710,122 T604S probably damaging Het
Ago3 T A 4: 126,355,091 T556S possibly damaging Het
Arap2 T C 5: 62,670,979 I950V possibly damaging Het
Arl5b A G 2: 15,073,179 E105G probably damaging Het
Capza3 A G 6: 140,042,538 I288V probably benign Het
Chka G A 19: 3,875,737 probably benign Het
Cnpy4 G T 5: 138,192,591 V159F probably damaging Het
Crb1 T C 1: 139,323,311 I301V probably benign Het
Disp1 T A 1: 183,087,644 I1071F possibly damaging Het
Dlec1 C T 9: 119,143,163 A1417V probably damaging Het
Dlgap1 T A 17: 70,766,043 S686T probably benign Het
Dync1li2 A G 8: 104,423,143 S411P probably damaging Het
Efnb2 T A 8: 8,620,698 S301C probably damaging Het
Enpp4 T C 17: 44,101,807 N279D probably benign Het
Ezh1 A G 11: 101,194,908 F641S probably damaging Het
Gcgr T A 11: 120,538,424 probably benign Het
Gm4887 G T 7: 104,821,328 noncoding transcript Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Htt G A 5: 34,849,069 V1441I possibly damaging Het
Lmtk2 A G 5: 144,183,226 M1398V probably benign Het
Lrrc15 T C 16: 30,273,855 N222S probably benign Het
Mctp2 A T 7: 72,259,331 V78E possibly damaging Het
Medag A G 5: 149,422,163 Y103C probably damaging Het
Mphosph9 G A 5: 124,304,203 P361S probably damaging Het
Npffr2 G A 5: 89,568,023 V70M probably damaging Het
Obox3-ps8 A C 17: 36,453,017 noncoding transcript Het
Olfr1222 A G 2: 89,125,362 V123A probably damaging Het
Pdgfra G A 5: 75,183,070 V751I probably benign Het
Phykpl T C 11: 51,585,528 L25P probably damaging Het
Rgl1 A T 1: 152,536,289 I443N probably benign Het
Riok3 AGAAGCGG AG 18: 12,135,941 probably benign Het
Rragd T C 4: 32,996,099 probably null Het
Rtcb A T 10: 85,957,619 M30K probably damaging Het
Rusc2 T A 4: 43,415,533 C280S probably damaging Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Skp2 C A 15: 9,116,860 probably null Het
Slc52a3 T A 2: 152,005,740 I256N possibly damaging Het
Sycp2 A T 2: 178,358,224 D986E probably benign Het
Tas1r1 T C 4: 152,032,157 E340G possibly damaging Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Trhr G A 15: 44,197,224 V47I probably damaging Het
Trpm2 A T 10: 77,933,642 N749K probably damaging Het
Ttc27 T A 17: 74,840,360 W636R probably damaging Het
Ttc30a1 A G 2: 75,980,474 Y422H probably damaging Het
Ttn C A 2: 76,778,347 R17775L probably damaging Het
Vmn2r55 A G 7: 12,668,179 F394S probably benign Het
Zfp52 C A 17: 21,560,197 Y102* probably null Het
Zyx A G 6: 42,350,946 D70G probably damaging Het
Other mutations in Exoc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Exoc3 APN 13 74206906 critical splice donor site probably null
IGL01444:Exoc3 APN 13 74206935 missense probably damaging 1.00
IGL02095:Exoc3 APN 13 74180536 missense probably damaging 1.00
IGL02370:Exoc3 APN 13 74192761 missense probably benign 0.02
IGL02704:Exoc3 APN 13 74174144 missense probably benign 0.00
IGL03113:Exoc3 APN 13 74193113 nonsense probably null
R0037:Exoc3 UTSW 13 74199539 missense probably damaging 0.99
R0565:Exoc3 UTSW 13 74182275 critical splice donor site probably null
R1282:Exoc3 UTSW 13 74182292 missense probably benign 0.30
R1438:Exoc3 UTSW 13 74190179 missense probably damaging 1.00
R1694:Exoc3 UTSW 13 74190065 splice site probably null
R1913:Exoc3 UTSW 13 74182316 missense probably damaging 1.00
R1915:Exoc3 UTSW 13 74173294 critical splice donor site probably null
R2039:Exoc3 UTSW 13 74192977 missense probably benign
R4852:Exoc3 UTSW 13 74199645 missense probably damaging 1.00
R5698:Exoc3 UTSW 13 74174015 missense probably benign 0.13
R5909:Exoc3 UTSW 13 74199524 missense probably damaging 0.98
R5969:Exoc3 UTSW 13 74172186 nonsense probably null
R6248:Exoc3 UTSW 13 74182281 missense probably benign 0.40
R6433:Exoc3 UTSW 13 74189187 missense possibly damaging 0.93
R6599:Exoc3 UTSW 13 74189158 splice site probably null
R6861:Exoc3 UTSW 13 74189200 missense probably benign
R7000:Exoc3 UTSW 13 74182166 missense probably benign 0.41
R7384:Exoc3 UTSW 13 74172156 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAACATGACAGGCTAGTTCATCC -3'
(R):5'- CGCCACCTGGAGATCATTAG -3'

Sequencing Primer
(F):5'- TCCTGAAGGATAAGTCACCAGCAG -3'
(R):5'- CCTGGAGATCATTAGGAAGTATGTCC -3'
Posted On2015-06-20