Mutagenetix > Incidental Mutation

Incidental Mutation 'R4272:Sall2'

322234

Institutional Source

Beutler Lab

Gene Symbol

Sall2

Ensembl Gene

ENSMUSG00000049532

Gene Name

spalt like transcription factor 2

Synonyms

Msal-2

MMRRC Submission

041644-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4272 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52311172-52328762 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 52313803 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 643 (R643L)

Ref Sequence

ENSEMBL: ENSMUSP00000154331 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]

AlphaFold

Q9QX96

Predicted Effect

probably damaging
Transcript: ENSMUST00000058326
AA Change: R645L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: R645L

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	97	110	N/A	INTRINSIC
low complexity region	128	139	N/A	INTRINSIC
low complexity region	151	170	N/A	INTRINSIC
ZnF_C2H2	372	394	2.57e-3	SMART
ZnF_C2H2	400	422	1.28e-3	SMART
low complexity region	476	501	N/A	INTRINSIC
low complexity region	602	627	N/A	INTRINSIC
ZnF_C2H2	629	651	1.2e1	SMART
ZnF_C2H2	657	679	1.69e-3	SMART
ZnF_C2H2	689	711	6.88e-4	SMART
low complexity region	719	730	N/A	INTRINSIC
low complexity region	747	779	N/A	INTRINSIC
low complexity region	799	819	N/A	INTRINSIC
low complexity region	829	848	N/A	INTRINSIC
ZnF_C2H2	908	930	2.09e-3	SMART
ZnF_C2H2	937	960	1.01e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000135523
AA Change: R643L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Meta Mutation Damage Score

0.2114

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrf2	T	A	17: 42,710,122	T604S	probably damaging	Het
Ago3	T	A	4: 126,355,091	T556S	possibly damaging	Het
Arap2	T	C	5: 62,670,979	I950V	possibly damaging	Het
Arl5b	A	G	2: 15,073,179	E105G	probably damaging	Het
Capza3	A	G	6: 140,042,538	I288V	probably benign	Het
Chka	G	A	19: 3,875,737		probably benign	Het
Cnpy4	G	T	5: 138,192,591	V159F	probably damaging	Het
Crb1	T	C	1: 139,323,311	I301V	probably benign	Het
Disp1	T	A	1: 183,087,644	I1071F	possibly damaging	Het
Dlec1	C	T	9: 119,143,163	A1417V	probably damaging	Het
Dlgap1	T	A	17: 70,766,043	S686T	probably benign	Het
Dync1li2	A	G	8: 104,423,143	S411P	probably damaging	Het
Efnb2	T	A	8: 8,620,698	S301C	probably damaging	Het
Enpp4	T	C	17: 44,101,807	N279D	probably benign	Het
Exoc3	A	G	13: 74,192,644	V347A	probably damaging	Het
Ezh1	A	G	11: 101,194,908	F641S	probably damaging	Het
Gcgr	T	A	11: 120,538,424		probably benign	Het
Gm4887	G	T	7: 104,821,328		noncoding transcript	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Htt	G	A	5: 34,849,069	V1441I	possibly damaging	Het
Lmtk2	A	G	5: 144,183,226	M1398V	probably benign	Het
Lrrc15	T	C	16: 30,273,855	N222S	probably benign	Het
Mctp2	A	T	7: 72,259,331	V78E	possibly damaging	Het
Medag	A	G	5: 149,422,163	Y103C	probably damaging	Het
Mphosph9	G	A	5: 124,304,203	P361S	probably damaging	Het
Npffr2	G	A	5: 89,568,023	V70M	probably damaging	Het
Obox3-ps8	A	C	17: 36,453,017		noncoding transcript	Het
Olfr1222	A	G	2: 89,125,362	V123A	probably damaging	Het
Pdgfra	G	A	5: 75,183,070	V751I	probably benign	Het
Phykpl	T	C	11: 51,585,528	L25P	probably damaging	Het
Rgl1	A	T	1: 152,536,289	I443N	probably benign	Het
Riok3	AGAAGCGG	AG	18: 12,135,941		probably benign	Het
Rragd	T	C	4: 32,996,099		probably null	Het
Rtcb	A	T	10: 85,957,619	M30K	probably damaging	Het
Rusc2	T	A	4: 43,415,533	C280S	probably damaging	Het
Skp2	C	A	15: 9,116,860		probably null	Het
Slc52a3	T	A	2: 152,005,740	I256N	possibly damaging	Het
Sycp2	A	T	2: 178,358,224	D986E	probably benign	Het
Tas1r1	T	C	4: 152,032,157	E340G	possibly damaging	Het
Tnpo1	GCACCTCTGCTTCCTC	GCACCTCTGCTTCCTCACCTCTGCTTCCTC	13: 98,867,129		probably null	Het
Trhr	G	A	15: 44,197,224	V47I	probably damaging	Het
Trpm2	A	T	10: 77,933,642	N749K	probably damaging	Het
Ttc27	T	A	17: 74,840,360	W636R	probably damaging	Het
Ttc30a1	A	G	2: 75,980,474	Y422H	probably damaging	Het
Ttn	C	A	2: 76,778,347	R17775L	probably damaging	Het
Vmn2r55	A	G	7: 12,668,179	F394S	probably benign	Het
Zfp52	C	A	17: 21,560,197	Y102*	probably null	Het
Zyx	A	G	6: 42,350,946	D70G	probably damaging	Het

Other mutations in Sall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Sall2	APN	14	52314571	missense	probably damaging	1.00
IGL02152:Sall2	APN	14	52315514	missense	probably damaging	1.00
IGL02318:Sall2	APN	14	52315565	missense	probably damaging	1.00
IGL02933:Sall2	APN	14	52313027	missense	probably benign	0.00
IGL03165:Sall2	APN	14	52314168	missense	probably damaging	1.00
R1079:Sall2	UTSW	14	52313203	missense	probably benign	0.13
R1295:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1674:Sall2	UTSW	14	52313836	missense	probably damaging	1.00
R1840:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1989:Sall2	UTSW	14	52314439	missense	probably damaging	1.00
R2339:Sall2	UTSW	14	52313356	missense	probably damaging	1.00
R3407:Sall2	UTSW	14	52328104	missense	probably benign	0.03
R3870:Sall2	UTSW	14	52313994	missense	probably damaging	1.00
R3895:Sall2	UTSW	14	52314047	missense	probably damaging	0.99
R4059:Sall2	UTSW	14	52314571	missense	probably damaging	1.00
R4273:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4275:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4289:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4503:Sall2	UTSW	14	52313459	missense	probably benign
R4592:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4611:Sall2	UTSW	14	52313753	missense	probably damaging	1.00
R4615:Sall2	UTSW	14	52312750	missense	probably benign	0.20
R4640:Sall2	UTSW	14	52315159	missense	probably damaging	0.99
R4693:Sall2	UTSW	14	52314478	missense	probably damaging	1.00
R4921:Sall2	UTSW	14	52315393	missense	possibly damaging	0.93
R5007:Sall2	UTSW	14	52314493	missense	probably damaging	1.00
R5015:Sall2	UTSW	14	52315655	missense	possibly damaging	0.92
R5079:Sall2	UTSW	14	52314754	missense	probably damaging	1.00
R5419:Sall2	UTSW	14	52313129	missense	probably damaging	1.00
R5849:Sall2	UTSW	14	52314247	missense	probably benign	0.13
R6229:Sall2	UTSW	14	52313191	missense	probably benign
R6397:Sall2	UTSW	14	52315153	missense	probably damaging	1.00
R6422:Sall2	UTSW	14	52312724	makesense	probably null
R6456:Sall2	UTSW	14	52313593	missense	probably damaging	1.00
R6456:Sall2	UTSW	14	52313594	nonsense	probably null
R6786:Sall2	UTSW	14	52314621	missense	probably damaging	1.00
R7293:Sall2	UTSW	14	52314411	nonsense	probably null
R7496:Sall2	UTSW	14	52315561	missense	possibly damaging	0.63
R7792:Sall2	UTSW	14	52316064	missense	probably damaging	1.00
R8324:Sall2	UTSW	14	52312886	missense	probably benign	0.30
R9017:Sall2	UTSW	14	52313262	missense	possibly damaging	0.51
R9149:Sall2	UTSW	14	52313216	missense	possibly damaging	0.95
R9362:Sall2	UTSW	14	52313144	nonsense	probably null
R9571:Sall2	UTSW	14	52314373	missense	probably damaging	1.00
R9574:Sall2	UTSW	14	52314160	missense	probably damaging	1.00
R9641:Sall2	UTSW	14	52313425	missense	probably damaging	1.00
R9648:Sall2	UTSW	14	52313767	missense	probably damaging	1.00
R9694:Sall2	UTSW	14	52314667	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- AACATGTTGCTGCAGAGTGAC -3'
(R):5'- CCCTTATGTGCTAGAACCCTTG -3'

Sequencing Primer
(F):5'- CAGAGTGACAGCATTAGTGAACTTC -3'
(R):5'- GCCTTCTGAGACCTCAAAGCTG -3'

Posted On

2015-06-20