Incidental Mutation 'R4272:Chka'
ID 322244
Institutional Source Beutler Lab
Gene Symbol Chka
Ensembl Gene ENSMUSG00000024843
Gene Name choline kinase alpha
Synonyms choline/ethanolamine kinase alpha, EtnK-alpha, CK/EK-alpha, Chk, ChoK
MMRRC Submission 041644-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4272 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 3851773-3894369 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 3875737 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025760] [ENSMUST00000072055] [ENSMUST00000128694] [ENSMUST00000153343]
AlphaFold O54804
Predicted Effect silent
Transcript: ENSMUST00000025760
SMART Domains Protein: ENSMUSP00000025760
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
Pfam:APH 108 373 2.4e-11 PFAM
Pfam:Choline_kinase 135 370 8.2e-82 PFAM
Pfam:EcKinase 211 345 2.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072055
SMART Domains Protein: ENSMUSP00000071933
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
Pfam:APH 108 358 6.4e-12 PFAM
Pfam:Choline_kinase 135 352 1.6e-84 PFAM
Pfam:EcKinase 190 329 2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125411
Predicted Effect probably benign
Transcript: ENSMUST00000125640
SMART Domains Protein: ENSMUSP00000119493
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
Pfam:Choline_kinase 40 230 2.2e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127544
Predicted Effect probably benign
Transcript: ENSMUST00000128694
SMART Domains Protein: ENSMUSP00000119919
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
PDB:4DA5|B 1 150 2e-60 PDB
Predicted Effect silent
Transcript: ENSMUST00000139655
SMART Domains Protein: ENSMUSP00000116427
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
PDB:4DA5|B 17 160 3e-68 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148325
Predicted Effect unknown
Transcript: ENSMUST00000153343
AA Change: G4D
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The major pathway for the biosynthesis of phosphatidylcholine occurs via the CDP-choline pathway. The protein encoded by this gene is the initial enzyme in the sequence and may play a regulatory role. The encoded protein also catalyzes the phosphorylation of ethanolamine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality between E3.5 and E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 T A 17: 42,710,122 T604S probably damaging Het
Ago3 T A 4: 126,355,091 T556S possibly damaging Het
Arap2 T C 5: 62,670,979 I950V possibly damaging Het
Arl5b A G 2: 15,073,179 E105G probably damaging Het
Capza3 A G 6: 140,042,538 I288V probably benign Het
Cnpy4 G T 5: 138,192,591 V159F probably damaging Het
Crb1 T C 1: 139,323,311 I301V probably benign Het
Disp1 T A 1: 183,087,644 I1071F possibly damaging Het
Dlec1 C T 9: 119,143,163 A1417V probably damaging Het
Dlgap1 T A 17: 70,766,043 S686T probably benign Het
Dync1li2 A G 8: 104,423,143 S411P probably damaging Het
Efnb2 T A 8: 8,620,698 S301C probably damaging Het
Enpp4 T C 17: 44,101,807 N279D probably benign Het
Exoc3 A G 13: 74,192,644 V347A probably damaging Het
Ezh1 A G 11: 101,194,908 F641S probably damaging Het
Gcgr T A 11: 120,538,424 probably benign Het
Gm4887 G T 7: 104,821,328 noncoding transcript Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Htt G A 5: 34,849,069 V1441I possibly damaging Het
Lmtk2 A G 5: 144,183,226 M1398V probably benign Het
Lrrc15 T C 16: 30,273,855 N222S probably benign Het
Mctp2 A T 7: 72,259,331 V78E possibly damaging Het
Medag A G 5: 149,422,163 Y103C probably damaging Het
Mphosph9 G A 5: 124,304,203 P361S probably damaging Het
Npffr2 G A 5: 89,568,023 V70M probably damaging Het
Obox3-ps8 A C 17: 36,453,017 noncoding transcript Het
Olfr1222 A G 2: 89,125,362 V123A probably damaging Het
Pdgfra G A 5: 75,183,070 V751I probably benign Het
Phykpl T C 11: 51,585,528 L25P probably damaging Het
Rgl1 A T 1: 152,536,289 I443N probably benign Het
Riok3 AGAAGCGG AG 18: 12,135,941 probably benign Het
Rragd T C 4: 32,996,099 probably null Het
Rtcb A T 10: 85,957,619 M30K probably damaging Het
Rusc2 T A 4: 43,415,533 C280S probably damaging Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Skp2 C A 15: 9,116,860 probably null Het
Slc52a3 T A 2: 152,005,740 I256N possibly damaging Het
Sycp2 A T 2: 178,358,224 D986E probably benign Het
Tas1r1 T C 4: 152,032,157 E340G possibly damaging Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Trhr G A 15: 44,197,224 V47I probably damaging Het
Trpm2 A T 10: 77,933,642 N749K probably damaging Het
Ttc27 T A 17: 74,840,360 W636R probably damaging Het
Ttc30a1 A G 2: 75,980,474 Y422H probably damaging Het
Ttn C A 2: 76,778,347 R17775L probably damaging Het
Vmn2r55 A G 7: 12,668,179 F394S probably benign Het
Zfp52 C A 17: 21,560,197 Y102* probably null Het
Zyx A G 6: 42,350,946 D70G probably damaging Het
Other mutations in Chka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Chka APN 19 3892189 missense probably benign 0.16
IGL02630:Chka APN 19 3892112 missense possibly damaging 0.94
R1432:Chka UTSW 19 3874809 splice site probably benign
R1840:Chka UTSW 19 3886460 missense probably benign 0.00
R1898:Chka UTSW 19 3892205 missense probably damaging 1.00
R3822:Chka UTSW 19 3882038 intron probably benign
R4329:Chka UTSW 19 3875803 splice site probably benign
R4573:Chka UTSW 19 3885960 missense probably damaging 1.00
R4720:Chka UTSW 19 3886375 missense probably damaging 0.99
R4923:Chka UTSW 19 3892105 critical splice acceptor site probably null
R5783:Chka UTSW 19 3864661 missense probably damaging 1.00
R5936:Chka UTSW 19 3884580 missense probably benign 0.25
R5979:Chka UTSW 19 3884513 missense probably damaging 1.00
R7429:Chka UTSW 19 3892787 missense probably damaging 1.00
R7430:Chka UTSW 19 3892787 missense probably damaging 1.00
R8189:Chka UTSW 19 3875759 nonsense probably null
R8213:Chka UTSW 19 3885882 missense probably damaging 1.00
R8397:Chka UTSW 19 3852414 critical splice donor site probably null
R8440:Chka UTSW 19 3893375 missense probably damaging 1.00
R9289:Chka UTSW 19 3885953 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TGGTCTCAGCAGTACATCCC -3'
(R):5'- TTTCAACTGGTCCAGAGCC -3'

Sequencing Primer
(F):5'- AAGCATTTGAAGGTTTTGGCAC -3'
(R):5'- GGTCCAGAGCCCTTCTTTTGAAAAAG -3'
Posted On 2015-06-20