Incidental Mutation 'R4273:Fmo4'
ID322247
Institutional Source Beutler Lab
Gene Symbol Fmo4
Ensembl Gene ENSMUSG00000026692
Gene Nameflavin containing monooxygenase 4
Synonyms
MMRRC Submission 041645-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R4273 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location162793188-162813972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 162805179 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 201 (V201A)
Ref Sequence ENSEMBL: ENSMUSP00000107150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028014] [ENSMUST00000111525] [ENSMUST00000140274] [ENSMUST00000144916]
Predicted Effect probably damaging
Transcript: ENSMUST00000028014
AA Change: V201A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028014
Gene: ENSMUSG00000026692
AA Change: V201A

DomainStartEndE-ValueType
Pfam:FMO-like 2 531 9.4e-272 PFAM
Pfam:Pyr_redox_2 4 430 1e-8 PFAM
Pfam:Pyr_redox_3 6 220 5.1e-16 PFAM
Pfam:K_oxygenase 68 227 1.7e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111525
AA Change: V201A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107150
Gene: ENSMUSG00000026692
AA Change: V201A

DomainStartEndE-ValueType
Pfam:FMO-like 2 531 9.4e-272 PFAM
Pfam:Pyr_redox_2 3 225 1.7e-11 PFAM
Pfam:Pyr_redox_3 6 220 2.5e-9 PFAM
Pfam:K_oxygenase 67 227 6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140031
Predicted Effect probably benign
Transcript: ENSMUST00000140274
SMART Domains Protein: ENSMUSP00000118476
Gene: ENSMUSG00000026692

DomainStartEndE-ValueType
Pfam:FMO-like 2 99 1.5e-57 PFAM
Pfam:NAD_binding_8 7 94 1.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144916
SMART Domains Protein: ENSMUSP00000119389
Gene: ENSMUSG00000026692

DomainStartEndE-ValueType
Pfam:FMO-like 1 114 2.6e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193508
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metabolic N-oxidation of diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man. This results in a small subpopulation with reduced TMA N-oxidation capacity and causes fish odor syndrome (Trimethylaminuria). Three forms of the enzyme are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,598 probably null Het
Adgrf2 T A 17: 42,710,122 T604S probably damaging Het
Akap8l T A 17: 32,321,931 K533* probably null Het
Appbp2 T C 11: 85,234,676 Y45C probably damaging Het
Arap2 T C 5: 62,670,979 I950V possibly damaging Het
Arhgap31 T C 16: 38,602,335 E1123G possibly damaging Het
Atp2c1 G T 9: 105,435,140 N493K probably benign Het
Bcr T C 10: 75,125,111 I458T probably damaging Het
Brd4 G A 17: 32,214,782 T468I probably benign Het
Cdh23 T A 10: 60,311,161 D2774V possibly damaging Het
Cfdp1 T C 8: 111,768,785 Y267C probably damaging Het
Chd6 C A 2: 160,961,291 A2156S probably benign Het
Dazap2 C A 15: 100,618,090 P100T probably damaging Het
Disp1 T A 1: 183,087,644 I1071F possibly damaging Het
Dlgap1 T A 17: 70,766,043 S686T probably benign Het
Dst C T 1: 34,192,340 R3183C possibly damaging Het
Enpp4 T C 17: 44,101,807 N279D probably benign Het
Exoc3l T C 8: 105,289,961 *740W probably null Het
Exoc5 A T 14: 49,015,480 C625* probably null Het
Fam98b A T 2: 117,260,231 N137Y possibly damaging Het
Fat4 T A 3: 38,891,627 D1556E probably damaging Het
Fcer2a C A 8: 3,682,848 V319L possibly damaging Het
Fer1l6 T C 15: 58,627,522 V1247A probably benign Het
Fras1 G A 5: 96,614,904 G755D probably benign Het
Gm13078 A T 4: 143,726,846 K175* probably null Het
Grid2 T C 6: 63,909,045 Y142H probably damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ibtk T C 9: 85,726,731 Q376R probably damaging Het
Impdh2 T C 9: 108,564,956 M414T probably damaging Het
Itm2c A G 1: 85,907,029 T160A probably damaging Het
Kcna2 T A 3: 107,105,193 D363E probably benign Het
Lama2 C T 10: 27,347,054 C412Y probably damaging Het
Lims2 C G 18: 31,956,337 T151S probably benign Het
Mier1 T C 4: 103,162,431 S423P possibly damaging Het
Mrgpra3 A T 7: 47,589,432 W249R probably benign Het
Mtor A G 4: 148,550,152 H2410R probably benign Het
Mvp C T 7: 126,989,703 A631T probably benign Het
Nepro T C 16: 44,735,829 V450A possibly damaging Het
Ngrn T C 7: 80,264,521 V140A probably damaging Het
Nobox T C 6: 43,306,008 E231G probably benign Het
Olfr129 A T 17: 38,055,272 I98N probably damaging Het
P3h2 T A 16: 26,105,221 I155F probably benign Het
Pcdha3 C T 18: 36,948,091 R629C probably damaging Het
Riok3 AGAAGCGG AG 18: 12,135,941 probably benign Het
Rttn T C 18: 89,091,896 I1675T probably benign Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Slc35f4 G T 14: 49,304,301 T182N possibly damaging Het
Slc52a3 T A 2: 152,005,740 I256N possibly damaging Het
Sox9 T C 11: 112,785,154 S390P possibly damaging Het
Tango2 T C 16: 18,302,790 probably benign Het
Tas1r1 T C 4: 152,032,157 E340G possibly damaging Het
Tek G A 4: 94,829,970 G524R probably damaging Het
Tmem260 A T 14: 48,505,304 Y532F probably benign Het
Tsks C A 7: 44,957,929 L559I probably damaging Het
Unc79 C A 12: 103,122,353 L1702I probably damaging Het
Vmn1r14 T A 6: 57,234,148 I237N probably damaging Het
Vmn2r17 G A 5: 109,452,966 C710Y probably benign Het
Zfp119b G T 17: 55,938,926 T420K possibly damaging Het
Zfp202 C T 9: 40,207,494 R68* probably null Het
Zfp229 T A 17: 21,746,821 S677R probably benign Het
Zfp462 C T 4: 55,008,411 H126Y probably benign Het
Zfp52 C A 17: 21,560,197 Y102* probably null Het
Zfp616 T A 11: 74,083,700 M265K probably benign Het
Zfyve9 A T 4: 108,680,976 I1031N probably damaging Het
Zmynd11 T C 13: 9,697,690 Y203C probably damaging Het
Other mutations in Fmo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Fmo4 APN 1 162794023 missense probably benign 0.00
IGL01090:Fmo4 APN 1 162809785 splice site probably null
IGL01295:Fmo4 APN 1 162799124 missense probably damaging 1.00
IGL02089:Fmo4 APN 1 162799080 missense probably benign 0.04
IGL02483:Fmo4 APN 1 162808421 missense possibly damaging 0.60
R0608:Fmo4 UTSW 1 162803651 missense possibly damaging 0.95
R0660:Fmo4 UTSW 1 162809848 missense probably benign 0.05
R0737:Fmo4 UTSW 1 162808392 nonsense probably null
R1117:Fmo4 UTSW 1 162803663 missense probably benign 0.03
R1464:Fmo4 UTSW 1 162794355 missense possibly damaging 0.54
R1464:Fmo4 UTSW 1 162794355 missense possibly damaging 0.54
R1577:Fmo4 UTSW 1 162803700 missense possibly damaging 0.50
R1792:Fmo4 UTSW 1 162794290 missense probably benign
R1875:Fmo4 UTSW 1 162803618 missense possibly damaging 0.95
R1929:Fmo4 UTSW 1 162799047 missense possibly damaging 0.95
R1956:Fmo4 UTSW 1 162803690 missense probably benign 0.01
R1957:Fmo4 UTSW 1 162803690 missense probably benign 0.01
R1958:Fmo4 UTSW 1 162803690 missense probably benign 0.01
R2011:Fmo4 UTSW 1 162798889 missense probably damaging 1.00
R2030:Fmo4 UTSW 1 162794172 missense probably damaging 1.00
R2072:Fmo4 UTSW 1 162809887 missense probably benign 0.20
R2272:Fmo4 UTSW 1 162799047 missense possibly damaging 0.95
R3890:Fmo4 UTSW 1 162794055 missense probably benign 0.39
R4255:Fmo4 UTSW 1 162794326 missense probably benign 0.00
R4760:Fmo4 UTSW 1 162809827 missense probably damaging 1.00
R5445:Fmo4 UTSW 1 162805273 missense probably benign 0.24
R5726:Fmo4 UTSW 1 162808259 critical splice donor site probably null
R5786:Fmo4 UTSW 1 162803717 missense probably benign 0.00
R6391:Fmo4 UTSW 1 162793969 nonsense probably null
R6826:Fmo4 UTSW 1 162803769 missense probably damaging 1.00
R7457:Fmo4 UTSW 1 162794103 missense probably benign 0.00
R7913:Fmo4 UTSW 1 162794172 missense possibly damaging 0.69
R8031:Fmo4 UTSW 1 162798852 nonsense probably null
R8055:Fmo4 UTSW 1 162808446 missense probably benign
R8234:Fmo4 UTSW 1 162805188 missense probably damaging 1.00
R8346:Fmo4 UTSW 1 162794223 missense probably benign 0.01
X0020:Fmo4 UTSW 1 162794378 missense probably benign 0.02
Z1177:Fmo4 UTSW 1 162803720 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTTTCTGAAAGAGCAGACCAAG -3'
(R):5'- CTGCAAGTGGTGATACAAGC -3'

Sequencing Primer
(F):5'- CCAAGAGTGGCTTTGGGAC -3'
(R):5'- GTGGTGATACAAGCAGCAAGTTTCTC -3'
Posted On2015-06-20