Incidental Mutation 'R4273:Fmo4'
ID 322247
Institutional Source Beutler Lab
Gene Symbol Fmo4
Ensembl Gene ENSMUSG00000026692
Gene Name flavin containing monooxygenase 4
Synonyms
MMRRC Submission 041645-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R4273 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 162620757-162641541 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 162632748 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 201 (V201A)
Ref Sequence ENSEMBL: ENSMUSP00000107150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028014] [ENSMUST00000111525] [ENSMUST00000140274] [ENSMUST00000144916]
AlphaFold Q8VHG0
Predicted Effect probably damaging
Transcript: ENSMUST00000028014
AA Change: V201A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028014
Gene: ENSMUSG00000026692
AA Change: V201A

DomainStartEndE-ValueType
Pfam:FMO-like 2 531 9.4e-272 PFAM
Pfam:Pyr_redox_2 4 430 1e-8 PFAM
Pfam:Pyr_redox_3 6 220 5.1e-16 PFAM
Pfam:K_oxygenase 68 227 1.7e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111525
AA Change: V201A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107150
Gene: ENSMUSG00000026692
AA Change: V201A

DomainStartEndE-ValueType
Pfam:FMO-like 2 531 9.4e-272 PFAM
Pfam:Pyr_redox_2 3 225 1.7e-11 PFAM
Pfam:Pyr_redox_3 6 220 2.5e-9 PFAM
Pfam:K_oxygenase 67 227 6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140031
Predicted Effect probably benign
Transcript: ENSMUST00000140274
SMART Domains Protein: ENSMUSP00000118476
Gene: ENSMUSG00000026692

DomainStartEndE-ValueType
Pfam:FMO-like 2 99 1.5e-57 PFAM
Pfam:NAD_binding_8 7 94 1.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144916
SMART Domains Protein: ENSMUSP00000119389
Gene: ENSMUSG00000026692

DomainStartEndE-ValueType
Pfam:FMO-like 1 114 2.6e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193508
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metabolic N-oxidation of diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man. This results in a small subpopulation with reduced TMA N-oxidation capacity and causes fish odor syndrome (Trimethylaminuria). Three forms of the enzyme are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,792,835 (GRCm39) probably null Het
Adgrf2 T A 17: 43,021,013 (GRCm39) T604S probably damaging Het
Akap8l T A 17: 32,540,905 (GRCm39) K533* probably null Het
Appbp2 T C 11: 85,125,502 (GRCm39) Y45C probably damaging Het
Arap2 T C 5: 62,828,322 (GRCm39) I950V possibly damaging Het
Arhgap31 T C 16: 38,422,697 (GRCm39) E1123G possibly damaging Het
Atp2c1 G T 9: 105,312,339 (GRCm39) N493K probably benign Het
Bcr T C 10: 74,960,943 (GRCm39) I458T probably damaging Het
Brd4 G A 17: 32,433,756 (GRCm39) T468I probably benign Het
Cdh23 T A 10: 60,146,940 (GRCm39) D2774V possibly damaging Het
Cfdp1 T C 8: 112,495,417 (GRCm39) Y267C probably damaging Het
Chd6 C A 2: 160,803,211 (GRCm39) A2156S probably benign Het
Dazap2 C A 15: 100,515,971 (GRCm39) P100T probably damaging Het
Disp1 T A 1: 182,869,208 (GRCm39) I1071F possibly damaging Het
Dlgap1 T A 17: 71,073,038 (GRCm39) S686T probably benign Het
Dst C T 1: 34,231,421 (GRCm39) R3183C possibly damaging Het
Enpp4 T C 17: 44,412,698 (GRCm39) N279D probably benign Het
Exoc3l T C 8: 106,016,593 (GRCm39) *740W probably null Het
Exoc5 A T 14: 49,252,937 (GRCm39) C625* probably null Het
Fam98b A T 2: 117,090,712 (GRCm39) N137Y possibly damaging Het
Fat4 T A 3: 38,945,776 (GRCm39) D1556E probably damaging Het
Fcer2a C A 8: 3,732,848 (GRCm39) V319L possibly damaging Het
Fer1l6 T C 15: 58,499,371 (GRCm39) V1247A probably benign Het
Fras1 G A 5: 96,762,763 (GRCm39) G755D probably benign Het
Grid2 T C 6: 63,886,029 (GRCm39) Y142H probably damaging Het
Hspg2 C T 4: 137,246,251 (GRCm39) R1010C probably damaging Het
Ibtk T C 9: 85,608,784 (GRCm39) Q376R probably damaging Het
Impdh2 T C 9: 108,442,155 (GRCm39) M414T probably damaging Het
Itm2c A G 1: 85,834,750 (GRCm39) T160A probably damaging Het
Kcna2 T A 3: 107,012,509 (GRCm39) D363E probably benign Het
Lama2 C T 10: 27,223,050 (GRCm39) C412Y probably damaging Het
Lims2 C G 18: 32,089,390 (GRCm39) T151S probably benign Het
Mier1 T C 4: 103,019,628 (GRCm39) S423P possibly damaging Het
Mrgpra3 A T 7: 47,239,180 (GRCm39) W249R probably benign Het
Mtor A G 4: 148,634,609 (GRCm39) H2410R probably benign Het
Mvp C T 7: 126,588,875 (GRCm39) A631T probably benign Het
Nepro T C 16: 44,556,192 (GRCm39) V450A possibly damaging Het
Ngrn T C 7: 79,914,269 (GRCm39) V140A probably damaging Het
Nobox T C 6: 43,282,942 (GRCm39) E231G probably benign Het
Or10al7 A T 17: 38,366,163 (GRCm39) I98N probably damaging Het
P3h2 T A 16: 25,923,971 (GRCm39) I155F probably benign Het
Pcdha3 C T 18: 37,081,144 (GRCm39) R629C probably damaging Het
Pramel24 A T 4: 143,453,416 (GRCm39) K175* probably null Het
Riok3 AGAAGCGG AG 18: 12,268,998 (GRCm39) probably benign Het
Rttn T C 18: 89,110,020 (GRCm39) I1675T probably benign Het
Sall2 C A 14: 52,551,260 (GRCm39) R643L probably damaging Het
Slc35f4 G T 14: 49,541,758 (GRCm39) T182N possibly damaging Het
Slc52a3 T A 2: 151,847,660 (GRCm39) I256N possibly damaging Het
Sox9 T C 11: 112,675,980 (GRCm39) S390P possibly damaging Het
Tango2 T C 16: 18,120,654 (GRCm39) probably benign Het
Tas1r1 T C 4: 152,116,614 (GRCm39) E340G possibly damaging Het
Tek G A 4: 94,718,207 (GRCm39) G524R probably damaging Het
Tmem260 A T 14: 48,742,761 (GRCm39) Y532F probably benign Het
Tsks C A 7: 44,607,353 (GRCm39) L559I probably damaging Het
Unc79 C A 12: 103,088,612 (GRCm39) L1702I probably damaging Het
Vmn1r14 T A 6: 57,211,133 (GRCm39) I237N probably damaging Het
Vmn2r17 G A 5: 109,600,832 (GRCm39) C710Y probably benign Het
Zfp119b G T 17: 56,245,926 (GRCm39) T420K possibly damaging Het
Zfp202 C T 9: 40,118,790 (GRCm39) R68* probably null Het
Zfp229 T A 17: 21,965,802 (GRCm39) S677R probably benign Het
Zfp462 C T 4: 55,008,411 (GRCm39) H126Y probably benign Het
Zfp52 C A 17: 21,780,459 (GRCm39) Y102* probably null Het
Zfp616 T A 11: 73,974,526 (GRCm39) M265K probably benign Het
Zfyve9 A T 4: 108,538,173 (GRCm39) I1031N probably damaging Het
Zmynd11 T C 13: 9,747,726 (GRCm39) Y203C probably damaging Het
Other mutations in Fmo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Fmo4 APN 1 162,621,592 (GRCm39) missense probably benign 0.00
IGL01090:Fmo4 APN 1 162,637,354 (GRCm39) splice site probably null
IGL01295:Fmo4 APN 1 162,626,693 (GRCm39) missense probably damaging 1.00
IGL02089:Fmo4 APN 1 162,626,649 (GRCm39) missense probably benign 0.04
IGL02483:Fmo4 APN 1 162,635,990 (GRCm39) missense possibly damaging 0.60
R0608:Fmo4 UTSW 1 162,631,220 (GRCm39) missense possibly damaging 0.95
R0660:Fmo4 UTSW 1 162,637,417 (GRCm39) missense probably benign 0.05
R0737:Fmo4 UTSW 1 162,635,961 (GRCm39) nonsense probably null
R1117:Fmo4 UTSW 1 162,631,232 (GRCm39) missense probably benign 0.03
R1464:Fmo4 UTSW 1 162,621,924 (GRCm39) missense possibly damaging 0.54
R1464:Fmo4 UTSW 1 162,621,924 (GRCm39) missense possibly damaging 0.54
R1577:Fmo4 UTSW 1 162,631,269 (GRCm39) missense possibly damaging 0.50
R1792:Fmo4 UTSW 1 162,621,859 (GRCm39) missense probably benign
R1875:Fmo4 UTSW 1 162,631,187 (GRCm39) missense possibly damaging 0.95
R1929:Fmo4 UTSW 1 162,626,616 (GRCm39) missense possibly damaging 0.95
R1956:Fmo4 UTSW 1 162,631,259 (GRCm39) missense probably benign 0.01
R1957:Fmo4 UTSW 1 162,631,259 (GRCm39) missense probably benign 0.01
R1958:Fmo4 UTSW 1 162,631,259 (GRCm39) missense probably benign 0.01
R2011:Fmo4 UTSW 1 162,626,458 (GRCm39) missense probably damaging 1.00
R2030:Fmo4 UTSW 1 162,621,741 (GRCm39) missense probably damaging 1.00
R2072:Fmo4 UTSW 1 162,637,456 (GRCm39) missense probably benign 0.20
R2272:Fmo4 UTSW 1 162,626,616 (GRCm39) missense possibly damaging 0.95
R3890:Fmo4 UTSW 1 162,621,624 (GRCm39) missense probably benign 0.39
R4255:Fmo4 UTSW 1 162,621,895 (GRCm39) missense probably benign 0.00
R4760:Fmo4 UTSW 1 162,637,396 (GRCm39) missense probably damaging 1.00
R5445:Fmo4 UTSW 1 162,632,842 (GRCm39) missense probably benign 0.24
R5726:Fmo4 UTSW 1 162,635,828 (GRCm39) critical splice donor site probably null
R5786:Fmo4 UTSW 1 162,631,286 (GRCm39) missense probably benign 0.00
R6391:Fmo4 UTSW 1 162,621,538 (GRCm39) nonsense probably null
R6826:Fmo4 UTSW 1 162,631,338 (GRCm39) missense probably damaging 1.00
R7457:Fmo4 UTSW 1 162,621,672 (GRCm39) missense probably benign 0.00
R7913:Fmo4 UTSW 1 162,621,741 (GRCm39) missense possibly damaging 0.69
R8031:Fmo4 UTSW 1 162,626,421 (GRCm39) nonsense probably null
R8055:Fmo4 UTSW 1 162,636,015 (GRCm39) missense probably benign
R8234:Fmo4 UTSW 1 162,632,757 (GRCm39) missense probably damaging 1.00
R8346:Fmo4 UTSW 1 162,621,792 (GRCm39) missense probably benign 0.01
R8706:Fmo4 UTSW 1 162,621,592 (GRCm39) nonsense probably null
R9050:Fmo4 UTSW 1 162,635,099 (GRCm39) missense probably benign 0.15
R9467:Fmo4 UTSW 1 162,631,238 (GRCm39) missense probably benign
R9488:Fmo4 UTSW 1 162,631,337 (GRCm39) missense probably damaging 1.00
R9633:Fmo4 UTSW 1 162,631,191 (GRCm39) missense probably benign 0.00
X0020:Fmo4 UTSW 1 162,621,947 (GRCm39) missense probably benign 0.02
Z1177:Fmo4 UTSW 1 162,631,289 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTTTCTGAAAGAGCAGACCAAG -3'
(R):5'- CTGCAAGTGGTGATACAAGC -3'

Sequencing Primer
(F):5'- CCAAGAGTGGCTTTGGGAC -3'
(R):5'- GTGGTGATACAAGCAGCAAGTTTCTC -3'
Posted On 2015-06-20