Mutagenetix > Incidental Mutation

Incidental Mutation 'R4273:Disp1'

322248

Institutional Source

Beutler Lab

Gene Symbol

Disp1

Ensembl Gene

ENSMUSG00000030768

Gene Name

dispatched RND transporter family member 1

Synonyms

1190008H24Rik, DispA

MMRRC Submission

041645-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.921) question?

Stock #

R4273 (G1)

Quality Score

210

Status

Not validated

Chromosome

Chromosomal Location

183086266-183221522 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 183087644 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 1071 (I1071F)

Ref Sequence

ENSEMBL: ENSMUSP00000141747 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003035] [ENSMUST00000171366] [ENSMUST00000195372]

AlphaFold

Q3TDN0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000003035
AA Change: I1071F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000003035
Gene: ENSMUSG00000030768
AA Change: I1071F

Domain	Start	End	E-Value	Type
low complexity region	11	35	N/A	INTRINSIC
low complexity region	71	89	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Patched	279	765	6.8e-20	PFAM
Pfam:MMPL	496	691	6.6e-13	PFAM
Pfam:Sterol-sensing	518	670	1.7e-15	PFAM
Pfam:Patched	916	1130	8e-11	PFAM
Pfam:MMPL	937	1144	3.9e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171366
AA Change: I1071F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000126742
Gene: ENSMUSG00000030768
AA Change: I1071F

Domain	Start	End	E-Value	Type
low complexity region	11	35	N/A	INTRINSIC
low complexity region	71	89	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Patched	272	766	2.6e-20	PFAM
Pfam:MMPL	496	691	6.6e-13	PFAM
Pfam:Sterol-sensing	516	671	2.2e-15	PFAM
Pfam:Patched	921	1130	8.7e-11	PFAM
Pfam:MMPL	937	1144	3.9e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000195372
AA Change: I1071F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000141747
Gene: ENSMUSG00000030768
AA Change: I1071F

Domain	Start	End	E-Value	Type
low complexity region	11	35	N/A	INTRINSIC
low complexity region	71	89	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Patched	272	766	2.6e-20	PFAM
Pfam:MMPL	496	691	6.6e-13	PFAM
Pfam:Sterol-sensing	516	671	2.2e-15	PFAM
Pfam:Patched	921	1130	8.7e-11	PFAM
Pfam:MMPL	937	1144	3.9e-9	PFAM

Meta Mutation Damage Score

0.2425

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted and chemically induced mutations exhibit a dorsalized neural tube, impaired heart looping, pericardial edema, large forelimbs, and abnormal head shape. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer2	T	A	4: 86,874,598		probably null	Het
Adgrf2	T	A	17: 42,710,122	T604S	probably damaging	Het
Akap8l	T	A	17: 32,321,931	K533*	probably null	Het
Appbp2	T	C	11: 85,234,676	Y45C	probably damaging	Het
Arap2	T	C	5: 62,670,979	I950V	possibly damaging	Het
Arhgap31	T	C	16: 38,602,335	E1123G	possibly damaging	Het
Atp2c1	G	T	9: 105,435,140	N493K	probably benign	Het
Bcr	T	C	10: 75,125,111	I458T	probably damaging	Het
Brd4	G	A	17: 32,214,782	T468I	probably benign	Het
Cdh23	T	A	10: 60,311,161	D2774V	possibly damaging	Het
Cfdp1	T	C	8: 111,768,785	Y267C	probably damaging	Het
Chd6	C	A	2: 160,961,291	A2156S	probably benign	Het
Dazap2	C	A	15: 100,618,090	P100T	probably damaging	Het
Dlgap1	T	A	17: 70,766,043	S686T	probably benign	Het
Dst	C	T	1: 34,192,340	R3183C	possibly damaging	Het
Enpp4	T	C	17: 44,101,807	N279D	probably benign	Het
Exoc3l	T	C	8: 105,289,961	*740W	probably null	Het
Exoc5	A	T	14: 49,015,480	C625*	probably null	Het
Fam98b	A	T	2: 117,260,231	N137Y	possibly damaging	Het
Fat4	T	A	3: 38,891,627	D1556E	probably damaging	Het
Fcer2a	C	A	8: 3,682,848	V319L	possibly damaging	Het
Fer1l6	T	C	15: 58,627,522	V1247A	probably benign	Het
Fmo4	A	G	1: 162,805,179	V201A	probably damaging	Het
Fras1	G	A	5: 96,614,904	G755D	probably benign	Het
Gm13078	A	T	4: 143,726,846	K175*	probably null	Het
Grid2	T	C	6: 63,909,045	Y142H	probably damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Ibtk	T	C	9: 85,726,731	Q376R	probably damaging	Het
Impdh2	T	C	9: 108,564,956	M414T	probably damaging	Het
Itm2c	A	G	1: 85,907,029	T160A	probably damaging	Het
Kcna2	T	A	3: 107,105,193	D363E	probably benign	Het
Lama2	C	T	10: 27,347,054	C412Y	probably damaging	Het
Lims2	C	G	18: 31,956,337	T151S	probably benign	Het
Mier1	T	C	4: 103,162,431	S423P	possibly damaging	Het
Mrgpra3	A	T	7: 47,589,432	W249R	probably benign	Het
Mtor	A	G	4: 148,550,152	H2410R	probably benign	Het
Mvp	C	T	7: 126,989,703	A631T	probably benign	Het
Nepro	T	C	16: 44,735,829	V450A	possibly damaging	Het
Ngrn	T	C	7: 80,264,521	V140A	probably damaging	Het
Nobox	T	C	6: 43,306,008	E231G	probably benign	Het
Olfr129	A	T	17: 38,055,272	I98N	probably damaging	Het
P3h2	T	A	16: 26,105,221	I155F	probably benign	Het
Pcdha3	C	T	18: 36,948,091	R629C	probably damaging	Het
Riok3	AGAAGCGG	AG	18: 12,135,941		probably benign	Het
Rttn	T	C	18: 89,091,896	I1675T	probably benign	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Slc35f4	G	T	14: 49,304,301	T182N	possibly damaging	Het
Slc52a3	T	A	2: 152,005,740	I256N	possibly damaging	Het
Sox9	T	C	11: 112,785,154	S390P	possibly damaging	Het
Tango2	T	C	16: 18,302,790		probably benign	Het
Tas1r1	T	C	4: 152,032,157	E340G	possibly damaging	Het
Tek	G	A	4: 94,829,970	G524R	probably damaging	Het
Tmem260	A	T	14: 48,505,304	Y532F	probably benign	Het
Tsks	C	A	7: 44,957,929	L559I	probably damaging	Het
Unc79	C	A	12: 103,122,353	L1702I	probably damaging	Het
Vmn1r14	T	A	6: 57,234,148	I237N	probably damaging	Het
Vmn2r17	G	A	5: 109,452,966	C710Y	probably benign	Het
Zfp119b	G	T	17: 55,938,926	T420K	possibly damaging	Het
Zfp202	C	T	9: 40,207,494	R68*	probably null	Het
Zfp229	T	A	17: 21,746,821	S677R	probably benign	Het
Zfp462	C	T	4: 55,008,411	H126Y	probably benign	Het
Zfp52	C	A	17: 21,560,197	Y102*	probably null	Het
Zfp616	T	A	11: 74,083,700	M265K	probably benign	Het
Zfyve9	A	T	4: 108,680,976	I1031N	probably damaging	Het
Zmynd11	T	C	13: 9,697,690	Y203C	probably damaging	Het

Other mutations in Disp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
BB006:Disp1	UTSW	1	183135539	missense	probably benign
BB016:Disp1	UTSW	1	183135539	missense	probably benign
R1120:Disp1	UTSW	1	183098575	missense	probably benign	0.24
R1482:Disp1	UTSW	1	183086474	missense	possibly damaging	0.61
R1655:Disp1	UTSW	1	183087004	missense	probably benign	0.01
R1660:Disp1	UTSW	1	183087742	missense	probably damaging	1.00
R1816:Disp1	UTSW	1	183098575	missense	probably damaging	0.99
R1835:Disp1	UTSW	1	183089000	missense	probably damaging	1.00
R1954:Disp1	UTSW	1	183088543	missense	probably damaging	0.99
R2025:Disp1	UTSW	1	183088203	missense	probably damaging	1.00
R2136:Disp1	UTSW	1	183088378	missense	probably damaging	1.00
R2150:Disp1	UTSW	1	183088372	missense	probably damaging	1.00
R2207:Disp1	UTSW	1	183088342	missense	possibly damaging	0.94
R2392:Disp1	UTSW	1	183087167	missense	probably benign
R2831:Disp1	UTSW	1	183089319	small deletion	probably benign
R3111:Disp1	UTSW	1	183087523	missense	probably damaging	1.00
R3116:Disp1	UTSW	1	183088922	missense	probably benign	0.01
R3160:Disp1	UTSW	1	183087242	missense	probably benign	0.09
R3161:Disp1	UTSW	1	183087242	missense	probably benign	0.09
R3162:Disp1	UTSW	1	183087242	missense	probably benign	0.09
R3162:Disp1	UTSW	1	183087242	missense	probably benign	0.09
R3716:Disp1	UTSW	1	183087751	missense	probably damaging	1.00
R3914:Disp1	UTSW	1	183089102	missense	probably benign	0.05
R4061:Disp1	UTSW	1	183087700	missense	probably damaging	0.96
R4191:Disp1	UTSW	1	183089173	missense	probably damaging	1.00
R4261:Disp1	UTSW	1	183089386	missense	probably damaging	1.00
R4272:Disp1	UTSW	1	183087644	missense	possibly damaging	0.95
R4351:Disp1	UTSW	1	183099978	missense	probably benign	0.01
R4672:Disp1	UTSW	1	183098651	critical splice acceptor site	probably null
R4764:Disp1	UTSW	1	183088096	missense	probably damaging	1.00
R4910:Disp1	UTSW	1	183135463	missense	probably damaging	1.00
R5150:Disp1	UTSW	1	183089499	missense	probably damaging	0.98
R5502:Disp1	UTSW	1	183087886	missense	probably damaging	1.00
R5616:Disp1	UTSW	1	183088349	missense	probably benign	0.30
R5699:Disp1	UTSW	1	183088555	nonsense	probably null
R5813:Disp1	UTSW	1	183088410	missense	probably damaging	1.00
R5820:Disp1	UTSW	1	183135587	missense	probably benign	0.00
R6184:Disp1	UTSW	1	183086332	missense	probably benign	0.00
R6228:Disp1	UTSW	1	183099025	missense	possibly damaging	0.59
R6306:Disp1	UTSW	1	183087148	missense	possibly damaging	0.93
R6505:Disp1	UTSW	1	183086512	missense	probably benign	0.02
R6925:Disp1	UTSW	1	183086478	missense	probably benign
R7016:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7045:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7046:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7047:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7114:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7123:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7124:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7125:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7161:Disp1	UTSW	1	183087625	missense	possibly damaging	0.84
R7510:Disp1	UTSW	1	183088411	missense	probably damaging	1.00
R7756:Disp1	UTSW	1	183089734	missense	probably damaging	1.00
R7800:Disp1	UTSW	1	183098986	missense	probably benign	0.00
R7929:Disp1	UTSW	1	183135539	missense	probably benign
R8029:Disp1	UTSW	1	183089288	missense	probably damaging	1.00
R8036:Disp1	UTSW	1	183089239	missense	probably damaging	1.00
R8045:Disp1	UTSW	1	183089230	missense	probably damaging	1.00
R8054:Disp1	UTSW	1	183088248	nonsense	probably null
R8061:Disp1	UTSW	1	183087587	missense	probably damaging	1.00
R8094:Disp1	UTSW	1	183087628	missense	probably damaging	1.00
R8130:Disp1	UTSW	1	183135635	missense	probably benign	0.13
R8731:Disp1	UTSW	1	183087508	missense	possibly damaging	0.65
R9076:Disp1	UTSW	1	183087235	missense	possibly damaging	0.59
R9490:Disp1	UTSW	1	183089528	missense	probably benign	0.03
R9712:Disp1	UTSW	1	183135815	missense	probably damaging	0.99
R9745:Disp1	UTSW	1	183087746	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTGTAGGGAAAGGGATCTGGCC -3'
(R):5'- TCATAAGCCTGTACGCCATCG -3'

Sequencing Primer
(F):5'- CCAGGCACCGACACAGG -3'
(R):5'- GCCATCGTCTCCATAGCTGG -3'

Posted On

2015-06-20