Incidental Mutation 'R4273:Fam98b'
ID 322249
Institutional Source Beutler Lab
Gene Symbol Fam98b
Ensembl Gene ENSMUSG00000027349
Gene Name family with sequence similarity 98, member B
Synonyms 2610510H03Rik
MMRRC Submission 041645-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.713) question?
Stock # R4273 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 117080220-117102021 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 117090712 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 137 (N137Y)
Ref Sequence ENSEMBL: ENSMUSP00000028825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028825]
AlphaFold Q80VD1
Predicted Effect possibly damaging
Transcript: ENSMUST00000028825
AA Change: N137Y

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028825
Gene: ENSMUSG00000027349
AA Change: N137Y

DomainStartEndE-ValueType
Pfam:DUF2465 17 331 2e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143612
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,792,835 (GRCm39) probably null Het
Adgrf2 T A 17: 43,021,013 (GRCm39) T604S probably damaging Het
Akap8l T A 17: 32,540,905 (GRCm39) K533* probably null Het
Appbp2 T C 11: 85,125,502 (GRCm39) Y45C probably damaging Het
Arap2 T C 5: 62,828,322 (GRCm39) I950V possibly damaging Het
Arhgap31 T C 16: 38,422,697 (GRCm39) E1123G possibly damaging Het
Atp2c1 G T 9: 105,312,339 (GRCm39) N493K probably benign Het
Bcr T C 10: 74,960,943 (GRCm39) I458T probably damaging Het
Brd4 G A 17: 32,433,756 (GRCm39) T468I probably benign Het
Cdh23 T A 10: 60,146,940 (GRCm39) D2774V possibly damaging Het
Cfdp1 T C 8: 112,495,417 (GRCm39) Y267C probably damaging Het
Chd6 C A 2: 160,803,211 (GRCm39) A2156S probably benign Het
Dazap2 C A 15: 100,515,971 (GRCm39) P100T probably damaging Het
Disp1 T A 1: 182,869,208 (GRCm39) I1071F possibly damaging Het
Dlgap1 T A 17: 71,073,038 (GRCm39) S686T probably benign Het
Dst C T 1: 34,231,421 (GRCm39) R3183C possibly damaging Het
Enpp4 T C 17: 44,412,698 (GRCm39) N279D probably benign Het
Exoc3l T C 8: 106,016,593 (GRCm39) *740W probably null Het
Exoc5 A T 14: 49,252,937 (GRCm39) C625* probably null Het
Fat4 T A 3: 38,945,776 (GRCm39) D1556E probably damaging Het
Fcer2a C A 8: 3,732,848 (GRCm39) V319L possibly damaging Het
Fer1l6 T C 15: 58,499,371 (GRCm39) V1247A probably benign Het
Fmo4 A G 1: 162,632,748 (GRCm39) V201A probably damaging Het
Fras1 G A 5: 96,762,763 (GRCm39) G755D probably benign Het
Grid2 T C 6: 63,886,029 (GRCm39) Y142H probably damaging Het
Hspg2 C T 4: 137,246,251 (GRCm39) R1010C probably damaging Het
Ibtk T C 9: 85,608,784 (GRCm39) Q376R probably damaging Het
Impdh2 T C 9: 108,442,155 (GRCm39) M414T probably damaging Het
Itm2c A G 1: 85,834,750 (GRCm39) T160A probably damaging Het
Kcna2 T A 3: 107,012,509 (GRCm39) D363E probably benign Het
Lama2 C T 10: 27,223,050 (GRCm39) C412Y probably damaging Het
Lims2 C G 18: 32,089,390 (GRCm39) T151S probably benign Het
Mier1 T C 4: 103,019,628 (GRCm39) S423P possibly damaging Het
Mrgpra3 A T 7: 47,239,180 (GRCm39) W249R probably benign Het
Mtor A G 4: 148,634,609 (GRCm39) H2410R probably benign Het
Mvp C T 7: 126,588,875 (GRCm39) A631T probably benign Het
Nepro T C 16: 44,556,192 (GRCm39) V450A possibly damaging Het
Ngrn T C 7: 79,914,269 (GRCm39) V140A probably damaging Het
Nobox T C 6: 43,282,942 (GRCm39) E231G probably benign Het
Or10al7 A T 17: 38,366,163 (GRCm39) I98N probably damaging Het
P3h2 T A 16: 25,923,971 (GRCm39) I155F probably benign Het
Pcdha3 C T 18: 37,081,144 (GRCm39) R629C probably damaging Het
Pramel24 A T 4: 143,453,416 (GRCm39) K175* probably null Het
Riok3 AGAAGCGG AG 18: 12,268,998 (GRCm39) probably benign Het
Rttn T C 18: 89,110,020 (GRCm39) I1675T probably benign Het
Sall2 C A 14: 52,551,260 (GRCm39) R643L probably damaging Het
Slc35f4 G T 14: 49,541,758 (GRCm39) T182N possibly damaging Het
Slc52a3 T A 2: 151,847,660 (GRCm39) I256N possibly damaging Het
Sox9 T C 11: 112,675,980 (GRCm39) S390P possibly damaging Het
Tango2 T C 16: 18,120,654 (GRCm39) probably benign Het
Tas1r1 T C 4: 152,116,614 (GRCm39) E340G possibly damaging Het
Tek G A 4: 94,718,207 (GRCm39) G524R probably damaging Het
Tmem260 A T 14: 48,742,761 (GRCm39) Y532F probably benign Het
Tsks C A 7: 44,607,353 (GRCm39) L559I probably damaging Het
Unc79 C A 12: 103,088,612 (GRCm39) L1702I probably damaging Het
Vmn1r14 T A 6: 57,211,133 (GRCm39) I237N probably damaging Het
Vmn2r17 G A 5: 109,600,832 (GRCm39) C710Y probably benign Het
Zfp119b G T 17: 56,245,926 (GRCm39) T420K possibly damaging Het
Zfp202 C T 9: 40,118,790 (GRCm39) R68* probably null Het
Zfp229 T A 17: 21,965,802 (GRCm39) S677R probably benign Het
Zfp462 C T 4: 55,008,411 (GRCm39) H126Y probably benign Het
Zfp52 C A 17: 21,780,459 (GRCm39) Y102* probably null Het
Zfp616 T A 11: 73,974,526 (GRCm39) M265K probably benign Het
Zfyve9 A T 4: 108,538,173 (GRCm39) I1031N probably damaging Het
Zmynd11 T C 13: 9,747,726 (GRCm39) Y203C probably damaging Het
Other mutations in Fam98b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02642:Fam98b APN 2 117,090,793 (GRCm39) missense probably benign 0.34
IGL03175:Fam98b APN 2 117,089,719 (GRCm39) missense probably benign 0.24
R0384:Fam98b UTSW 2 117,098,328 (GRCm39) missense possibly damaging 0.95
R1035:Fam98b UTSW 2 117,101,120 (GRCm39) missense possibly damaging 0.84
R2207:Fam98b UTSW 2 117,098,300 (GRCm39) missense probably damaging 1.00
R3121:Fam98b UTSW 2 117,098,408 (GRCm39) missense probably damaging 0.98
R5276:Fam98b UTSW 2 117,089,779 (GRCm39) missense possibly damaging 0.94
R5325:Fam98b UTSW 2 117,101,132 (GRCm39) missense possibly damaging 0.91
R5460:Fam98b UTSW 2 117,089,737 (GRCm39) missense probably damaging 1.00
R5616:Fam98b UTSW 2 117,098,267 (GRCm39) missense possibly damaging 0.92
R5627:Fam98b UTSW 2 117,098,414 (GRCm39) missense probably damaging 1.00
R6787:Fam98b UTSW 2 117,093,402 (GRCm39) critical splice donor site probably null
R7252:Fam98b UTSW 2 117,094,373 (GRCm39) missense probably damaging 1.00
R7502:Fam98b UTSW 2 117,094,344 (GRCm39) missense probably damaging 1.00
R8182:Fam98b UTSW 2 117,080,302 (GRCm39) missense probably damaging 1.00
R8272:Fam98b UTSW 2 117,093,335 (GRCm39) missense probably benign 0.00
R8439:Fam98b UTSW 2 117,101,381 (GRCm39) missense unknown
R9454:Fam98b UTSW 2 117,080,250 (GRCm39) start codon destroyed probably null 0.99
Predicted Primers PCR Primer
(F):5'- ACTTGAGGTGTTCTATAGCTGC -3'
(R):5'- TATCACCAATATGGACTCCGAGTAC -3'

Sequencing Primer
(F):5'- GATTTTGATAGTGTTAATACTTGtt -3'
(R):5'- CTATGTATCACAACTAAAGGGAACG -3'
Posted On 2015-06-20