Mutagenetix > Incidental Mutation

Incidental Mutation 'R4273:Tek'

322256

Institutional Source

Beutler Lab

Gene Symbol

Tek

Ensembl Gene

ENSMUSG00000006386

Gene Name

TEK receptor tyrosine kinase

Synonyms

Cd202b, Hyk, tie-2, Tie2

MMRRC Submission

041645-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4273 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

94739289-94874976 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 94829970 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 524 (G524R)

Ref Sequence

ENSEMBL: ENSMUSP00000099862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071168] [ENSMUST00000073939] [ENSMUST00000102798]

AlphaFold

Q02858

Predicted Effect

probably damaging
Transcript: ENSMUST00000071168
AA Change: G524R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071162
Gene: ENSMUSG00000006386
AA Change: G524R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Ig_Tie2_1	23	118	1.2e-57	PFAM
IG_like	128	209	6.52e0	SMART
EGF_Lam	227	264	1.26e-2	SMART
EGF	267	299	2.2e1	SMART
internal_repeat_1	302	346	4.35e-7	PROSPERO
IG_like	356	442	3.29e1	SMART
FN3	445	526	2.11e0	SMART
FN3	541	624	9.77e-5	SMART
FN3	638	720	1.18e-12	SMART
transmembrane domain	747	769	N/A	INTRINSIC
TyrKc	822	1090	1.9e-138	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000073939
AA Change: G473R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073595
Gene: ENSMUSG00000006386
AA Change: G473R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Ig_Tie2_1	23	118	7.1e-58	PFAM
EGF_Lam	176	213	1.26e-2	SMART
EGF	216	248	2.2e1	SMART
internal_repeat_1	251	295	4.22e-7	PROSPERO
FN3	394	475	2.11e0	SMART
FN3	490	573	9.77e-5	SMART
FN3	587	669	1.18e-12	SMART
transmembrane domain	696	718	N/A	INTRINSIC
TyrKc	772	1040	1.9e-138	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102798
AA Change: G524R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099862
Gene: ENSMUSG00000006386
AA Change: G524R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Ig_Tie2_1	24	118	5e-44	PFAM
IG_like	128	209	6.52e0	SMART
EGF_Lam	227	264	1.26e-2	SMART
EGF	267	299	2.2e1	SMART
internal_repeat_1	302	346	4.36e-7	PROSPERO
IG_like	356	442	3.29e1	SMART
FN3	445	526	2.11e0	SMART
FN3	541	624	9.77e-5	SMART
FN3	638	720	1.18e-12	SMART
transmembrane domain	747	769	N/A	INTRINSIC
TyrKc	823	1091	1.9e-138	SMART

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor that belongs to the protein tyrosine kinase Tie2 family. The encoded protein possesses a unique extracellular region that contains two immunoglobulin-like domains, three epidermal growth factor (EGF)-like domains and three fibronectin type III repeats. The ligand angiopoietin-1 binds to this receptor and mediates a signaling pathway that functions in embryonic vascular development. Mutations in this gene are associated with inherited venous malformations of the skin and mucous membranes. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during organogenesis, impaired vascular branching in the embryo and yolk sac, abnormal cardiac development, and in some cases hemorrhages. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer2	T	A	4: 86,874,598		probably null	Het
Adgrf2	T	A	17: 42,710,122	T604S	probably damaging	Het
Akap8l	T	A	17: 32,321,931	K533*	probably null	Het
Appbp2	T	C	11: 85,234,676	Y45C	probably damaging	Het
Arap2	T	C	5: 62,670,979	I950V	possibly damaging	Het
Arhgap31	T	C	16: 38,602,335	E1123G	possibly damaging	Het
Atp2c1	G	T	9: 105,435,140	N493K	probably benign	Het
Bcr	T	C	10: 75,125,111	I458T	probably damaging	Het
Brd4	G	A	17: 32,214,782	T468I	probably benign	Het
Cdh23	T	A	10: 60,311,161	D2774V	possibly damaging	Het
Cfdp1	T	C	8: 111,768,785	Y267C	probably damaging	Het
Chd6	C	A	2: 160,961,291	A2156S	probably benign	Het
Dazap2	C	A	15: 100,618,090	P100T	probably damaging	Het
Disp1	T	A	1: 183,087,644	I1071F	possibly damaging	Het
Dlgap1	T	A	17: 70,766,043	S686T	probably benign	Het
Dst	C	T	1: 34,192,340	R3183C	possibly damaging	Het
Enpp4	T	C	17: 44,101,807	N279D	probably benign	Het
Exoc3l	T	C	8: 105,289,961	*740W	probably null	Het
Exoc5	A	T	14: 49,015,480	C625*	probably null	Het
Fam98b	A	T	2: 117,260,231	N137Y	possibly damaging	Het
Fat4	T	A	3: 38,891,627	D1556E	probably damaging	Het
Fcer2a	C	A	8: 3,682,848	V319L	possibly damaging	Het
Fer1l6	T	C	15: 58,627,522	V1247A	probably benign	Het
Fmo4	A	G	1: 162,805,179	V201A	probably damaging	Het
Fras1	G	A	5: 96,614,904	G755D	probably benign	Het
Gm13078	A	T	4: 143,726,846	K175*	probably null	Het
Grid2	T	C	6: 63,909,045	Y142H	probably damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Ibtk	T	C	9: 85,726,731	Q376R	probably damaging	Het
Impdh2	T	C	9: 108,564,956	M414T	probably damaging	Het
Itm2c	A	G	1: 85,907,029	T160A	probably damaging	Het
Kcna2	T	A	3: 107,105,193	D363E	probably benign	Het
Lama2	C	T	10: 27,347,054	C412Y	probably damaging	Het
Lims2	C	G	18: 31,956,337	T151S	probably benign	Het
Mier1	T	C	4: 103,162,431	S423P	possibly damaging	Het
Mrgpra3	A	T	7: 47,589,432	W249R	probably benign	Het
Mtor	A	G	4: 148,550,152	H2410R	probably benign	Het
Mvp	C	T	7: 126,989,703	A631T	probably benign	Het
Nepro	T	C	16: 44,735,829	V450A	possibly damaging	Het
Ngrn	T	C	7: 80,264,521	V140A	probably damaging	Het
Nobox	T	C	6: 43,306,008	E231G	probably benign	Het
Olfr129	A	T	17: 38,055,272	I98N	probably damaging	Het
P3h2	T	A	16: 26,105,221	I155F	probably benign	Het
Pcdha3	C	T	18: 36,948,091	R629C	probably damaging	Het
Riok3	AGAAGCGG	AG	18: 12,135,941		probably benign	Het
Rttn	T	C	18: 89,091,896	I1675T	probably benign	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Slc35f4	G	T	14: 49,304,301	T182N	possibly damaging	Het
Slc52a3	T	A	2: 152,005,740	I256N	possibly damaging	Het
Sox9	T	C	11: 112,785,154	S390P	possibly damaging	Het
Tango2	T	C	16: 18,302,790		probably benign	Het
Tas1r1	T	C	4: 152,032,157	E340G	possibly damaging	Het
Tmem260	A	T	14: 48,505,304	Y532F	probably benign	Het
Tsks	C	A	7: 44,957,929	L559I	probably damaging	Het
Unc79	C	A	12: 103,122,353	L1702I	probably damaging	Het
Vmn1r14	T	A	6: 57,234,148	I237N	probably damaging	Het
Vmn2r17	G	A	5: 109,452,966	C710Y	probably benign	Het
Zfp119b	G	T	17: 55,938,926	T420K	possibly damaging	Het
Zfp202	C	T	9: 40,207,494	R68*	probably null	Het
Zfp229	T	A	17: 21,746,821	S677R	probably benign	Het
Zfp462	C	T	4: 55,008,411	H126Y	probably benign	Het
Zfp52	C	A	17: 21,560,197	Y102*	probably null	Het
Zfp616	T	A	11: 74,083,700	M265K	probably benign	Het
Zfyve9	A	T	4: 108,680,976	I1031N	probably damaging	Het
Zmynd11	T	C	13: 9,697,690	Y203C	probably damaging	Het

Other mutations in Tek

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00654:Tek	APN	4	94827301	missense	probably benign	0.03
IGL00805:Tek	APN	4	94798719	missense	probably damaging	1.00
IGL00806:Tek	APN	4	94798719	missense	probably damaging	1.00
IGL00807:Tek	APN	4	94798719	missense	probably damaging	1.00
IGL00870:Tek	APN	4	94873081	nonsense	probably null
IGL01348:Tek	APN	4	94859658	missense	probably damaging	1.00
IGL01398:Tek	APN	4	94849777	missense	probably damaging	1.00
IGL01683:Tek	APN	4	94858911	missense	probably damaging	1.00
IGL01827:Tek	APN	4	94739645	missense	probably benign	0.24
IGL02063:Tek	APN	4	94739645	missense	probably benign	0.24
IGL02218:Tek	APN	4	94855337	missense	probably damaging	1.00
IGL02502:Tek	APN	4	94853581	critical splice donor site	probably null
IGL02852:Tek	APN	4	94855324	missense	probably damaging	1.00
IGL02995:Tek	APN	4	94739640	utr 5 prime	probably benign
IGL03182:Tek	APN	4	94851765	missense	probably damaging	1.00
IGL03247:Tek	APN	4	94865443	missense	possibly damaging	0.85
IGL03014:Tek	UTSW	4	94827263	missense	probably benign	0.05
R0022:Tek	UTSW	4	94837272	missense	probably damaging	0.98
R0373:Tek	UTSW	4	94804341	missense	probably damaging	1.00
R0479:Tek	UTSW	4	94804312	missense	probably benign	0.01
R1178:Tek	UTSW	4	94804287	missense	probably damaging	1.00
R1289:Tek	UTSW	4	94804830	missense	probably damaging	1.00
R1331:Tek	UTSW	4	94739706	splice site	probably benign
R1502:Tek	UTSW	4	94781102	missense	probably damaging	1.00
R1606:Tek	UTSW	4	94849767	missense	probably damaging	0.99
R2073:Tek	UTSW	4	94827729	missense	probably benign	0.01
R2075:Tek	UTSW	4	94827729	missense	probably benign	0.01
R2230:Tek	UTSW	4	94811336	missense	probably damaging	1.00
R2851:Tek	UTSW	4	94820224	missense	probably benign	0.30
R2852:Tek	UTSW	4	94820224	missense	probably benign	0.30
R3775:Tek	UTSW	4	94804312	missense	probably benign	0.01
R3845:Tek	UTSW	4	94804872	missense	probably damaging	1.00
R4114:Tek	UTSW	4	94849683	missense	probably damaging	0.99
R4115:Tek	UTSW	4	94849683	missense	probably damaging	0.99
R4425:Tek	UTSW	4	94863667	missense	probably damaging	1.00
R4488:Tek	UTSW	4	94849756	missense	possibly damaging	0.72
R4579:Tek	UTSW	4	94863666	nonsense	probably null
R4623:Tek	UTSW	4	94863661	missense	probably damaging	1.00
R4651:Tek	UTSW	4	94780884	missense	probably damaging	1.00
R4652:Tek	UTSW	4	94780884	missense	probably damaging	1.00
R4723:Tek	UTSW	4	94799160	missense	possibly damaging	0.71
R5059:Tek	UTSW	4	94804314	missense	probably benign	0.10
R5652:Tek	UTSW	4	94855324	missense	probably damaging	1.00
R5793:Tek	UTSW	4	94820096	missense	probably benign	0.01
R5855:Tek	UTSW	4	94853553	missense	probably damaging	1.00
R5912:Tek	UTSW	4	94798640	missense	probably damaging	1.00
R6537:Tek	UTSW	4	94837324	missense	probably benign	0.19
R6727:Tek	UTSW	4	94853495	nonsense	probably null
R6835:Tek	UTSW	4	94853434	missense	possibly damaging	0.94
R6883:Tek	UTSW	4	94837189	missense	possibly damaging	0.89
R6887:Tek	UTSW	4	94804944	missense	probably damaging	1.00
R7027:Tek	UTSW	4	94865510	missense	probably damaging	1.00
R7108:Tek	UTSW	4	94853487	missense	probably damaging	1.00
R7121:Tek	UTSW	4	94811410	missense	probably benign	0.19
R7220:Tek	UTSW	4	94804304	missense	probably damaging	1.00
R7346:Tek	UTSW	4	94827296	missense	probably benign
R7417:Tek	UTSW	4	94811345	missense	probably benign
R7465:Tek	UTSW	4	94827826	critical splice donor site	probably null
R7818:Tek	UTSW	4	94827716	missense	possibly damaging	0.67
R7917:Tek	UTSW	4	94820135	missense	possibly damaging	0.89
R7942:Tek	UTSW	4	94851874	splice site	probably null
R7956:Tek	UTSW	4	94799343	splice site	probably null
R8098:Tek	UTSW	4	94827670	missense	probably benign	0.19
R8442:Tek	UTSW	4	94827685	missense	probably benign	0.04
R8523:Tek	UTSW	4	94799166	missense	probably benign	0.12
R8676:Tek	UTSW	4	94849837	missense	probably benign
R8787:Tek	UTSW	4	94849800	missense	probably damaging	1.00
R9020:Tek	UTSW	4	94820102	missense	probably benign	0.40
R9172:Tek	UTSW	4	94804346	missense	probably benign	0.02
R9429:Tek	UTSW	4	94827278	missense	probably benign
R9564:Tek	UTSW	4	94873935	missense	probably damaging	1.00
R9602:Tek	UTSW	4	94827731	missense	possibly damaging	0.91
R9643:Tek	UTSW	4	94804286	missense	possibly damaging	0.51
R9721:Tek	UTSW	4	94804302	missense	possibly damaging	0.94
R9722:Tek	UTSW	4	94804302	missense	possibly damaging	0.94
R9723:Tek	UTSW	4	94804302	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CCTTTATTTCACGGAGACACTG -3'
(R):5'- TTCCACAGCAAAGTCCTTCC -3'

Sequencing Primer
(F):5'- ATGCTGAAGCTTTCGGAC -3'
(R):5'- GCAAAGTCCTTCCACCTCCATC -3'

Posted On

2015-06-20