Mutagenetix > Incidental Mutation

Incidental Mutation 'R4273:Zfyve9'

322258

Institutional Source

Beutler Lab

Gene Symbol

Zfyve9

Ensembl Gene

ENSMUSG00000034557

Gene Name

zinc finger, FYVE domain containing 9

Synonyms

Madhip

MMRRC Submission

041645-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.629) question?

Stock #

R4273 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108637466-108780798 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 108680976 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1031 (I1031N)

Ref Sequence

ENSEMBL: ENSMUSP00000102268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042185] [ENSMUST00000106657] [ENSMUST00000106658]

AlphaFold

A2A8R0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042185
AA Change: I340N

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000039852
Gene: ENSMUSG00000034557
AA Change: I340N

Domain	Start	End	E-Value	Type
Blast:FYVE	7	40	4e-7	BLAST
Pfam:SARA	52	92	1e-25	PFAM
Pfam:DUF3480	328	681	1.4e-189	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000106657
AA Change: I1031N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102268
Gene: ENSMUSG00000034557
AA Change: I1031N

Domain	Start	End	E-Value	Type
low complexity region	230	243	N/A	INTRINSIC
low complexity region	471	487	N/A	INTRINSIC
low complexity region	578	587	N/A	INTRINSIC
Blast:FYVE	590	618	7e-6	BLAST
FYVE	663	731	2.38e-26	SMART
Pfam:SARA	745	783	1.3e-22	PFAM
Pfam:DUF3480	1020	1372	1e-178	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106658
AA Change: I972N

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000102269
Gene: ENSMUSG00000034557
AA Change: I972N

Domain	Start	End	E-Value	Type
low complexity region	230	243	N/A	INTRINSIC
low complexity region	471	487	N/A	INTRINSIC
low complexity region	578	587	N/A	INTRINSIC
Blast:FYVE	590	618	8e-6	BLAST
FYVE	663	731	2.38e-26	SMART
Pfam:DUF3480	960	1313	5.5e-189	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a double zinc finger motif-containing protein that participates in the transforming growth factor-beta (TGFB) signalling pathway. The encoded protein interacts directly with SMAD2 and SMAD3, and recruits SMAD2 to the TGFB receptor. There are multiple pseudogenes for this gene on chromosomes 2, 15, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer2	T	A	4: 86,874,598		probably null	Het
Adgrf2	T	A	17: 42,710,122	T604S	probably damaging	Het
Akap8l	T	A	17: 32,321,931	K533*	probably null	Het
Appbp2	T	C	11: 85,234,676	Y45C	probably damaging	Het
Arap2	T	C	5: 62,670,979	I950V	possibly damaging	Het
Arhgap31	T	C	16: 38,602,335	E1123G	possibly damaging	Het
Atp2c1	G	T	9: 105,435,140	N493K	probably benign	Het
Bcr	T	C	10: 75,125,111	I458T	probably damaging	Het
Brd4	G	A	17: 32,214,782	T468I	probably benign	Het
Cdh23	T	A	10: 60,311,161	D2774V	possibly damaging	Het
Cfdp1	T	C	8: 111,768,785	Y267C	probably damaging	Het
Chd6	C	A	2: 160,961,291	A2156S	probably benign	Het
Dazap2	C	A	15: 100,618,090	P100T	probably damaging	Het
Disp1	T	A	1: 183,087,644	I1071F	possibly damaging	Het
Dlgap1	T	A	17: 70,766,043	S686T	probably benign	Het
Dst	C	T	1: 34,192,340	R3183C	possibly damaging	Het
Enpp4	T	C	17: 44,101,807	N279D	probably benign	Het
Exoc3l	T	C	8: 105,289,961	*740W	probably null	Het
Exoc5	A	T	14: 49,015,480	C625*	probably null	Het
Fam98b	A	T	2: 117,260,231	N137Y	possibly damaging	Het
Fat4	T	A	3: 38,891,627	D1556E	probably damaging	Het
Fcer2a	C	A	8: 3,682,848	V319L	possibly damaging	Het
Fer1l6	T	C	15: 58,627,522	V1247A	probably benign	Het
Fmo4	A	G	1: 162,805,179	V201A	probably damaging	Het
Fras1	G	A	5: 96,614,904	G755D	probably benign	Het
Gm13078	A	T	4: 143,726,846	K175*	probably null	Het
Grid2	T	C	6: 63,909,045	Y142H	probably damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Ibtk	T	C	9: 85,726,731	Q376R	probably damaging	Het
Impdh2	T	C	9: 108,564,956	M414T	probably damaging	Het
Itm2c	A	G	1: 85,907,029	T160A	probably damaging	Het
Kcna2	T	A	3: 107,105,193	D363E	probably benign	Het
Lama2	C	T	10: 27,347,054	C412Y	probably damaging	Het
Lims2	C	G	18: 31,956,337	T151S	probably benign	Het
Mier1	T	C	4: 103,162,431	S423P	possibly damaging	Het
Mrgpra3	A	T	7: 47,589,432	W249R	probably benign	Het
Mtor	A	G	4: 148,550,152	H2410R	probably benign	Het
Mvp	C	T	7: 126,989,703	A631T	probably benign	Het
Nepro	T	C	16: 44,735,829	V450A	possibly damaging	Het
Ngrn	T	C	7: 80,264,521	V140A	probably damaging	Het
Nobox	T	C	6: 43,306,008	E231G	probably benign	Het
Olfr129	A	T	17: 38,055,272	I98N	probably damaging	Het
P3h2	T	A	16: 26,105,221	I155F	probably benign	Het
Pcdha3	C	T	18: 36,948,091	R629C	probably damaging	Het
Riok3	AGAAGCGG	AG	18: 12,135,941		probably benign	Het
Rttn	T	C	18: 89,091,896	I1675T	probably benign	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Slc35f4	G	T	14: 49,304,301	T182N	possibly damaging	Het
Slc52a3	T	A	2: 152,005,740	I256N	possibly damaging	Het
Sox9	T	C	11: 112,785,154	S390P	possibly damaging	Het
Tango2	T	C	16: 18,302,790		probably benign	Het
Tas1r1	T	C	4: 152,032,157	E340G	possibly damaging	Het
Tek	G	A	4: 94,829,970	G524R	probably damaging	Het
Tmem260	A	T	14: 48,505,304	Y532F	probably benign	Het
Tsks	C	A	7: 44,957,929	L559I	probably damaging	Het
Unc79	C	A	12: 103,122,353	L1702I	probably damaging	Het
Vmn1r14	T	A	6: 57,234,148	I237N	probably damaging	Het
Vmn2r17	G	A	5: 109,452,966	C710Y	probably benign	Het
Zfp119b	G	T	17: 55,938,926	T420K	possibly damaging	Het
Zfp202	C	T	9: 40,207,494	R68*	probably null	Het
Zfp229	T	A	17: 21,746,821	S677R	probably benign	Het
Zfp462	C	T	4: 55,008,411	H126Y	probably benign	Het
Zfp52	C	A	17: 21,560,197	Y102*	probably null	Het
Zfp616	T	A	11: 74,083,700	M265K	probably benign	Het
Zmynd11	T	C	13: 9,697,690	Y203C	probably damaging	Het

Other mutations in Zfyve9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Zfyve9	APN	4	108642107	missense	possibly damaging	0.85
IGL01161:Zfyve9	APN	4	108681064	missense	probably damaging	1.00
IGL01404:Zfyve9	APN	4	108682151	missense	probably damaging	1.00
IGL01451:Zfyve9	APN	4	108682260	missense	probably damaging	0.98
IGL01655:Zfyve9	APN	4	108642092	missense	probably damaging	1.00
IGL02567:Zfyve9	APN	4	108674523	missense	probably damaging	1.00
IGL02593:Zfyve9	APN	4	108682223	missense	possibly damaging	0.73
IGL03169:Zfyve9	APN	4	108695825	missense	probably damaging	1.00
IGL03206:Zfyve9	APN	4	108689209	missense	possibly damaging	0.88
IGL03288:Zfyve9	APN	4	108723799	splice site	probably benign
R0008:Zfyve9	UTSW	4	108718705	missense	possibly damaging	0.92
R0008:Zfyve9	UTSW	4	108718705	missense	possibly damaging	0.92
R0104:Zfyve9	UTSW	4	108718163	missense	probably damaging	1.00
R0104:Zfyve9	UTSW	4	108718163	missense	probably damaging	1.00
R0362:Zfyve9	UTSW	4	108680969	missense	probably damaging	0.96
R0502:Zfyve9	UTSW	4	108719764	nonsense	probably null
R0503:Zfyve9	UTSW	4	108719764	nonsense	probably null
R0557:Zfyve9	UTSW	4	108674511	missense	probably damaging	0.98
R0835:Zfyve9	UTSW	4	108718669	missense	probably damaging	0.99
R1215:Zfyve9	UTSW	4	108650229	missense	probably benign	0.32
R1245:Zfyve9	UTSW	4	108693311	intron	probably benign
R1527:Zfyve9	UTSW	4	108695767	critical splice donor site	probably null
R1638:Zfyve9	UTSW	4	108684907	critical splice donor site	probably null
R1653:Zfyve9	UTSW	4	108660577	nonsense	probably null
R1728:Zfyve9	UTSW	4	108718501	missense	possibly damaging	0.80
R1729:Zfyve9	UTSW	4	108718501	missense	possibly damaging	0.80
R1861:Zfyve9	UTSW	4	108682295	splice site	probably benign
R1983:Zfyve9	UTSW	4	108689189	missense	possibly damaging	0.94
R2050:Zfyve9	UTSW	4	108718603	missense	probably benign	0.05
R2050:Zfyve9	UTSW	4	108719303	missense	possibly damaging	0.94
R2246:Zfyve9	UTSW	4	108689264	missense	possibly damaging	0.70
R2338:Zfyve9	UTSW	4	108660614	missense	probably damaging	1.00
R2697:Zfyve9	UTSW	4	108695819	missense	probably damaging	0.99
R3522:Zfyve9	UTSW	4	108719743	missense	probably benign	0.45
R4030:Zfyve9	UTSW	4	108719701	missense	possibly damaging	0.61
R4247:Zfyve9	UTSW	4	108719192	missense	probably benign	0.28
R4720:Zfyve9	UTSW	4	108644368	missense	possibly damaging	0.94
R4835:Zfyve9	UTSW	4	108717998	missense	possibly damaging	0.70
R4871:Zfyve9	UTSW	4	108680986	missense	probably damaging	1.00
R4881:Zfyve9	UTSW	4	108727491	splice site	probably null
R4974:Zfyve9	UTSW	4	108680900	critical splice donor site	probably null
R5024:Zfyve9	UTSW	4	108691669	missense	probably benign	0.18
R5481:Zfyve9	UTSW	4	108644349	missense	probably damaging	1.00
R5660:Zfyve9	UTSW	4	108719168	missense	probably benign
R5965:Zfyve9	UTSW	4	108691681	missense	possibly damaging	0.53
R5996:Zfyve9	UTSW	4	108719360	missense	probably benign	0.07
R6315:Zfyve9	UTSW	4	108674488	missense	probably damaging	1.00
R6772:Zfyve9	UTSW	4	108639269	missense	probably damaging	1.00
R6865:Zfyve9	UTSW	4	108644361	missense	possibly damaging	0.71
R7112:Zfyve9	UTSW	4	108650322	missense	probably benign	0.00
R7258:Zfyve9	UTSW	4	108656954	missense	possibly damaging	0.94
R7266:Zfyve9	UTSW	4	108718547	missense	possibly damaging	0.62
R7287:Zfyve9	UTSW	4	108718256	missense	probably benign	0.00
R7356:Zfyve9	UTSW	4	108719015	missense	probably benign	0.01
R7389:Zfyve9	UTSW	4	108693318	critical splice donor site	probably null
R7729:Zfyve9	UTSW	4	108691776	missense	probably benign	0.01
R7780:Zfyve9	UTSW	4	108719101	missense	possibly damaging	0.81
R7801:Zfyve9	UTSW	4	108684995	missense	possibly damaging	0.50
R8069:Zfyve9	UTSW	4	108685018	missense	probably benign	0.32
R8201:Zfyve9	UTSW	4	108650277	missense	possibly damaging	0.83
R8221:Zfyve9	UTSW	4	108719680	missense	possibly damaging	0.77
R8682:Zfyve9	UTSW	4	108719342	missense	probably benign	0.30
R8948:Zfyve9	UTSW	4	108642091	missense	possibly damaging	0.84
R8960:Zfyve9	UTSW	4	108644361	missense	possibly damaging	0.71
R9123:Zfyve9	UTSW	4	108718563	missense	probably benign	0.30
R9135:Zfyve9	UTSW	4	108682189	nonsense	probably null
R9439:Zfyve9	UTSW	4	108644341	missense	probably benign	0.33
R9449:Zfyve9	UTSW	4	108719238	missense	probably damaging	1.00
R9560:Zfyve9	UTSW	4	108718137	missense	possibly damaging	0.82
R9603:Zfyve9	UTSW	4	108642091	missense	possibly damaging	0.84
R9657:Zfyve9	UTSW	4	108718532	missense	probably damaging	1.00
R9691:Zfyve9	UTSW	4	108719108	missense	probably benign
R9717:Zfyve9	UTSW	4	108682137	missense	probably benign	0.11
Z1176:Zfyve9	UTSW	4	108642207	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- GCCAAGTACATTCAGACACTGG -3'
(R):5'- TTCACAGGGAAAGATTGGGAATTTG -3'

Sequencing Primer
(F):5'- GACACTGGTCATATTTAGTATGCCC -3'
(R):5'- AGGGAAAGATTGGGAATTTGTGTTTG -3'

Posted On

2015-06-20