Incidental Mutation 'R4273:Mtor'
ID 322262
Institutional Source Beutler Lab
Gene Symbol Mtor
Ensembl Gene ENSMUSG00000028991
Gene Name mechanistic target of rapamycin kinase
Synonyms RAPT1, FKBP-rapamycin-associated protein FRAP, RAFT1, flat, Frap1, 2610315D21Rik
MMRRC Submission 041645-MU
Accession Numbers

Ncbi RefSeq: NM_020009.2; MGI:1928394
Essential gene? Essential (E-score: 1.000) question?
Stock # R4273 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 148448611-148557683 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 148550152 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 2410 (H2410R)
Ref Sequence ENSEMBL: ENSMUSP00000099510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103221]
AlphaFold Q9JLN9
Predicted Effect probably benign
Transcript: ENSMUST00000103221
AA Change: H2410R

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: H2410R

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 179 191 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
low complexity region 774 790 N/A INTRINSIC
DUF3385 854 1024 1.51e-93 SMART
low complexity region 1279 1300 N/A INTRINSIC
Pfam:FAT 1513 1908 2.3e-134 PFAM
Rapamycin_bind 2015 2114 7.94e-61 SMART
PI3Kc 2183 2484 8.84e-121 SMART
FATC 2517 2549 2.11e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129715
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype Strain: 3529989; 4820819; 3512186; 5425404; 3052669
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,598 probably null Het
Adgrf2 T A 17: 42,710,122 T604S probably damaging Het
Akap8l T A 17: 32,321,931 K533* probably null Het
Appbp2 T C 11: 85,234,676 Y45C probably damaging Het
Arap2 T C 5: 62,670,979 I950V possibly damaging Het
Arhgap31 T C 16: 38,602,335 E1123G possibly damaging Het
Atp2c1 G T 9: 105,435,140 N493K probably benign Het
Bcr T C 10: 75,125,111 I458T probably damaging Het
Brd4 G A 17: 32,214,782 T468I probably benign Het
Cdh23 T A 10: 60,311,161 D2774V possibly damaging Het
Cfdp1 T C 8: 111,768,785 Y267C probably damaging Het
Chd6 C A 2: 160,961,291 A2156S probably benign Het
Dazap2 C A 15: 100,618,090 P100T probably damaging Het
Disp1 T A 1: 183,087,644 I1071F possibly damaging Het
Dlgap1 T A 17: 70,766,043 S686T probably benign Het
Dst C T 1: 34,192,340 R3183C possibly damaging Het
Enpp4 T C 17: 44,101,807 N279D probably benign Het
Exoc3l T C 8: 105,289,961 *740W probably null Het
Exoc5 A T 14: 49,015,480 C625* probably null Het
Fam98b A T 2: 117,260,231 N137Y possibly damaging Het
Fat4 T A 3: 38,891,627 D1556E probably damaging Het
Fcer2a C A 8: 3,682,848 V319L possibly damaging Het
Fer1l6 T C 15: 58,627,522 V1247A probably benign Het
Fmo4 A G 1: 162,805,179 V201A probably damaging Het
Fras1 G A 5: 96,614,904 G755D probably benign Het
Gm13078 A T 4: 143,726,846 K175* probably null Het
Grid2 T C 6: 63,909,045 Y142H probably damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ibtk T C 9: 85,726,731 Q376R probably damaging Het
Impdh2 T C 9: 108,564,956 M414T probably damaging Het
Itm2c A G 1: 85,907,029 T160A probably damaging Het
Kcna2 T A 3: 107,105,193 D363E probably benign Het
Lama2 C T 10: 27,347,054 C412Y probably damaging Het
Lims2 C G 18: 31,956,337 T151S probably benign Het
Mier1 T C 4: 103,162,431 S423P possibly damaging Het
Mrgpra3 A T 7: 47,589,432 W249R probably benign Het
Mvp C T 7: 126,989,703 A631T probably benign Het
Nepro T C 16: 44,735,829 V450A possibly damaging Het
Ngrn T C 7: 80,264,521 V140A probably damaging Het
Nobox T C 6: 43,306,008 E231G probably benign Het
Olfr129 A T 17: 38,055,272 I98N probably damaging Het
P3h2 T A 16: 26,105,221 I155F probably benign Het
Pcdha3 C T 18: 36,948,091 R629C probably damaging Het
Riok3 AGAAGCGG AG 18: 12,135,941 probably benign Het
Rttn T C 18: 89,091,896 I1675T probably benign Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Slc35f4 G T 14: 49,304,301 T182N possibly damaging Het
Slc52a3 T A 2: 152,005,740 I256N possibly damaging Het
Sox9 T C 11: 112,785,154 S390P possibly damaging Het
Tango2 T C 16: 18,302,790 probably benign Het
Tas1r1 T C 4: 152,032,157 E340G possibly damaging Het
Tek G A 4: 94,829,970 G524R probably damaging Het
Tmem260 A T 14: 48,505,304 Y532F probably benign Het
Tsks C A 7: 44,957,929 L559I probably damaging Het
Unc79 C A 12: 103,122,353 L1702I probably damaging Het
Vmn1r14 T A 6: 57,234,148 I237N probably damaging Het
Vmn2r17 G A 5: 109,452,966 C710Y probably benign Het
Zfp119b G T 17: 55,938,926 T420K possibly damaging Het
Zfp202 C T 9: 40,207,494 R68* probably null Het
Zfp229 T A 17: 21,746,821 S677R probably benign Het
Zfp462 C T 4: 55,008,411 H126Y probably benign Het
Zfp52 C A 17: 21,560,197 Y102* probably null Het
Zfp616 T A 11: 74,083,700 M265K probably benign Het
Zfyve9 A T 4: 108,680,976 I1031N probably damaging Het
Zmynd11 T C 13: 9,697,690 Y203C probably damaging Het
Other mutations in Mtor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Mtor APN 4 148453037 missense probably benign 0.06
IGL01447:Mtor APN 4 148530757 missense possibly damaging 0.62
IGL01551:Mtor APN 4 148472037 missense probably damaging 0.99
IGL01661:Mtor APN 4 148514851 missense possibly damaging 0.61
IGL01675:Mtor APN 4 148484654 missense probably benign 0.00
IGL01743:Mtor APN 4 148530613 splice site probably benign
IGL02015:Mtor APN 4 148540113 nonsense probably null
IGL02084:Mtor APN 4 148470680 missense probably damaging 0.98
IGL02095:Mtor APN 4 148544541 missense probably damaging 1.00
IGL02129:Mtor APN 4 148549845 missense possibly damaging 0.91
IGL02260:Mtor APN 4 148538301 missense probably damaging 1.00
IGL02329:Mtor APN 4 148534939 missense probably benign 0.16
IGL02440:Mtor APN 4 148546429 missense probably benign 0.24
IGL02440:Mtor APN 4 148491647 missense probably benign 0.04
IGL02449:Mtor APN 4 148533921 missense possibly damaging 0.65
IGL02479:Mtor APN 4 148470584 missense probably damaging 1.00
IGL02904:Mtor APN 4 148452394 missense possibly damaging 0.55
IGL02904:Mtor APN 4 148491612 splice site probably benign
IGL02931:Mtor APN 4 148464964 missense probably benign 0.22
IGL03048:Mtor APN 4 148546390 splice site probably benign
IGL03133:Mtor APN 4 148484319 missense probably benign 0.01
IGL03142:Mtor APN 4 148453899 missense probably benign 0.00
Brushes UTSW 4 148463748 missense probably benign 0.00
Dynamo UTSW 4 148462910 missense probably benign 0.00
engine UTSW 4 148556855 splice site probably null
Erg UTSW 4 148545596 missense probably damaging 1.00
Lindor UTSW 4 148454646 missense probably damaging 1.00
motor UTSW 4 148491360 missense possibly damaging 0.76
R4858_Mtor_211 UTSW 4 148454816 makesense probably null
Vigor UTSW 4 148538899 missense probably damaging 1.00
Vim UTSW 4 148525803 critical splice donor site probably null
PIT4519001:Mtor UTSW 4 148524500 missense probably damaging 1.00
R0045:Mtor UTSW 4 148464949 missense probably benign 0.42
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0103:Mtor UTSW 4 148533902 missense probably benign 0.05
R0112:Mtor UTSW 4 148480923 missense probably damaging 1.00
R0137:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R0184:Mtor UTSW 4 148464971 missense probably benign 0.05
R0208:Mtor UTSW 4 148464975 missense probably benign 0.43
R0329:Mtor UTSW 4 148484380 missense probably benign
R0330:Mtor UTSW 4 148484380 missense probably benign
R0365:Mtor UTSW 4 148486050 missense probably benign 0.01
R0537:Mtor UTSW 4 148538360 missense probably damaging 1.00
R0542:Mtor UTSW 4 148540450 missense probably benign 0.02
R0556:Mtor UTSW 4 148469380 missense possibly damaging 0.88
R0613:Mtor UTSW 4 148526046 missense possibly damaging 0.95
R0646:Mtor UTSW 4 148484354 nonsense probably null
R0710:Mtor UTSW 4 148464391 missense possibly damaging 0.73
R0791:Mtor UTSW 4 148462910 missense probably benign 0.00
R0792:Mtor UTSW 4 148462910 missense probably benign 0.00
R0866:Mtor UTSW 4 148486056 missense probably benign 0.04
R0973:Mtor UTSW 4 148550188 missense probably damaging 1.00
R1027:Mtor UTSW 4 148539999 missense probably benign 0.03
R1028:Mtor UTSW 4 148538830 missense possibly damaging 0.88
R1289:Mtor UTSW 4 148470307 missense probably benign 0.10
R1416:Mtor UTSW 4 148491414 nonsense probably null
R1465:Mtor UTSW 4 148525993 splice site probably benign
R1506:Mtor UTSW 4 148536505 splice site probably benign
R1624:Mtor UTSW 4 148547676 missense probably damaging 1.00
R1695:Mtor UTSW 4 148538907 missense probably benign 0.08
R1771:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R1800:Mtor UTSW 4 148462892 missense probably benign 0.00
R1855:Mtor UTSW 4 148553089 missense probably benign 0.02
R1857:Mtor UTSW 4 148480879 missense probably damaging 1.00
R1867:Mtor UTSW 4 148454632 missense probably damaging 0.97
R1954:Mtor UTSW 4 148468273 missense probably damaging 1.00
R2054:Mtor UTSW 4 148462852 missense probably benign 0.05
R2054:Mtor UTSW 4 148466025 missense probably benign 0.00
R2099:Mtor UTSW 4 148550192 nonsense probably null
R2148:Mtor UTSW 4 148456012 missense possibly damaging 0.56
R2214:Mtor UTSW 4 148538870 missense probably benign 0.39
R2281:Mtor UTSW 4 148489555 missense probably benign 0.02
R2512:Mtor UTSW 4 148530491 missense possibly damaging 0.95
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2873:Mtor UTSW 4 148540030 missense probably benign 0.00
R4032:Mtor UTSW 4 148536752 missense probably benign 0.03
R4073:Mtor UTSW 4 148549375 missense probably damaging 0.99
R4611:Mtor UTSW 4 148486119 missense probably benign 0.03
R4858:Mtor UTSW 4 148454816 makesense probably null
R4942:Mtor UTSW 4 148472142 missense probably benign 0.03
R4967:Mtor UTSW 4 148491360 missense possibly damaging 0.76
R4995:Mtor UTSW 4 148525752 missense probably damaging 1.00
R5054:Mtor UTSW 4 148556855 splice site probably null
R5215:Mtor UTSW 4 148453983 missense probably benign
R5249:Mtor UTSW 4 148463732 missense probably damaging 1.00
R5289:Mtor UTSW 4 148466092 missense possibly damaging 0.88
R5365:Mtor UTSW 4 148550130 missense probably damaging 0.99
R5498:Mtor UTSW 4 148540364 missense possibly damaging 0.71
R5514:Mtor UTSW 4 148546444 missense probably damaging 1.00
R5540:Mtor UTSW 4 148454708 missense probably benign 0.01
R5600:Mtor UTSW 4 148491470 missense probably damaging 1.00
R5615:Mtor UTSW 4 148538276 missense possibly damaging 0.95
R5632:Mtor UTSW 4 148469006 missense possibly damaging 0.94
R5641:Mtor UTSW 4 148546425 missense probably damaging 0.98
R5834:Mtor UTSW 4 148536536 missense possibly damaging 0.95
R5984:Mtor UTSW 4 148538827 missense probably benign 0.02
R6056:Mtor UTSW 4 148537435 missense probably benign 0.00
R6225:Mtor UTSW 4 148521337 missense probably benign 0.04
R6262:Mtor UTSW 4 148526095 missense possibly damaging 0.46
R6335:Mtor UTSW 4 148465927 missense probably damaging 1.00
R6479:Mtor UTSW 4 148551000 missense probably benign 0.16
R6543:Mtor UTSW 4 148545596 missense probably damaging 1.00
R6711:Mtor UTSW 4 148452367 missense possibly damaging 0.49
R6715:Mtor UTSW 4 148538547 missense probably benign 0.00
R6744:Mtor UTSW 4 148458655 missense probably benign 0.01
R6748:Mtor UTSW 4 148550184 missense probably damaging 1.00
R6762:Mtor UTSW 4 148538481 missense possibly damaging 0.47
R6836:Mtor UTSW 4 148489498 missense possibly damaging 0.94
R6948:Mtor UTSW 4 148536752 missense probably benign 0.12
R6979:Mtor UTSW 4 148524473 missense possibly damaging 0.60
R6992:Mtor UTSW 4 148464475 missense probably benign
R7271:Mtor UTSW 4 148546485 missense possibly damaging 0.70
R7423:Mtor UTSW 4 148556344 missense possibly damaging 0.77
R7434:Mtor UTSW 4 148464959 missense probably benign 0.39
R7619:Mtor UTSW 4 148462795 missense probably damaging 0.98
R7634:Mtor UTSW 4 148452350 missense possibly damaging 0.53
R7697:Mtor UTSW 4 148540308 nonsense probably null
R7737:Mtor UTSW 4 148538738 missense possibly damaging 0.95
R7791:Mtor UTSW 4 148462940 missense probably benign 0.00
R7858:Mtor UTSW 4 148454646 missense probably damaging 1.00
R8035:Mtor UTSW 4 148546399 missense probably benign 0.29
R8076:Mtor UTSW 4 148525803 critical splice donor site probably null
R8078:Mtor UTSW 4 148468287 missense probably benign
R8928:Mtor UTSW 4 148538899 missense probably damaging 1.00
R9040:Mtor UTSW 4 148463748 missense probably benign 0.00
R9116:Mtor UTSW 4 148552741 missense probably benign
R9284:Mtor UTSW 4 148459080 missense probably benign 0.03
R9310:Mtor UTSW 4 148469377 missense probably benign 0.03
R9374:Mtor UTSW 4 148514940 missense probably damaging 1.00
R9417:Mtor UTSW 4 148538319 nonsense probably null
R9465:Mtor UTSW 4 148540382 missense possibly damaging 0.92
R9492:Mtor UTSW 4 148484344 missense probably damaging 1.00
R9499:Mtor UTSW 4 148514940 missense probably damaging 1.00
R9516:Mtor UTSW 4 148484646 missense probably benign 0.23
R9600:Mtor UTSW 4 148547635 missense possibly damaging 0.82
R9622:Mtor UTSW 4 148483712 missense probably damaging 0.99
X0025:Mtor UTSW 4 148530714 missense probably benign 0.09
Z1176:Mtor UTSW 4 148550125 missense probably benign 0.08
Z1176:Mtor UTSW 4 148550130 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TTCTGTAGCAGGTCCCCAGTAC -3'
(R):5'- GCTCTGTAATTGTCAGGGACAC -3'

Sequencing Primer
(F):5'- GTCCCCAGTACTGTGTTAGAAATGAC -3'
(R):5'- TTGTCAGGGACACATACATACATAC -3'
Posted On 2015-06-20