Mutagenetix > Incidental Mutation

Incidental Mutation 'R4273:Arap2'

322264

Institutional Source

Beutler Lab

Gene Symbol

Arap2

Ensembl Gene

ENSMUSG00000037999

Gene Name

ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2

Synonyms

Centd1

MMRRC Submission

041645-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4273 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62602445-62766159 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 62670979 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 950 (I950V)

Ref Sequence

ENSEMBL: ENSMUSP00000075924 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076623]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000076623
AA Change: I950V

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000075924
Gene: ENSMUSG00000037999
AA Change: I950V

Domain	Start	End	E-Value	Type
SAM	3	70	3.69e-7	SMART
low complexity region	222	233	N/A	INTRINSIC
PH	481	574	6.45e-17	SMART
PH	586	679	9.05e-12	SMART
ArfGap	684	805	9.2e-33	SMART
PH	891	1003	1.51e-8	SMART
PH	1013	1112	9.21e-4	SMART
RhoGAP	1124	1300	1.36e-50	SMART
Pfam:RA	1325	1416	2.1e-7	PFAM
PH	1429	1533	2.68e-14	SMART
coiled coil region	1561	1590	N/A	INTRINSIC

Meta Mutation Damage Score

0.1244

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology domains. The protein is a phosphatidylinositol (3,4,5)-trisphosphate-dependent Arf6 GAP that binds RhoA-GTP, but it lacks the predicted catalytic arginine in the RHO-GAP domain and does not have RHO-GAP activity. The protein associates with focal adhesions and functions downstream of RhoA to regulate focal adhesion dynamics. [provided by RefSeq, Sep 2008]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer2	T	A	4: 86,874,598		probably null	Het
Adgrf2	T	A	17: 42,710,122	T604S	probably damaging	Het
Akap8l	T	A	17: 32,321,931	K533*	probably null	Het
Appbp2	T	C	11: 85,234,676	Y45C	probably damaging	Het
Arhgap31	T	C	16: 38,602,335	E1123G	possibly damaging	Het
Atp2c1	G	T	9: 105,435,140	N493K	probably benign	Het
Bcr	T	C	10: 75,125,111	I458T	probably damaging	Het
Brd4	G	A	17: 32,214,782	T468I	probably benign	Het
Cdh23	T	A	10: 60,311,161	D2774V	possibly damaging	Het
Cfdp1	T	C	8: 111,768,785	Y267C	probably damaging	Het
Chd6	C	A	2: 160,961,291	A2156S	probably benign	Het
Dazap2	C	A	15: 100,618,090	P100T	probably damaging	Het
Disp1	T	A	1: 183,087,644	I1071F	possibly damaging	Het
Dlgap1	T	A	17: 70,766,043	S686T	probably benign	Het
Dst	C	T	1: 34,192,340	R3183C	possibly damaging	Het
Enpp4	T	C	17: 44,101,807	N279D	probably benign	Het
Exoc3l	T	C	8: 105,289,961	*740W	probably null	Het
Exoc5	A	T	14: 49,015,480	C625*	probably null	Het
Fam98b	A	T	2: 117,260,231	N137Y	possibly damaging	Het
Fat4	T	A	3: 38,891,627	D1556E	probably damaging	Het
Fcer2a	C	A	8: 3,682,848	V319L	possibly damaging	Het
Fer1l6	T	C	15: 58,627,522	V1247A	probably benign	Het
Fmo4	A	G	1: 162,805,179	V201A	probably damaging	Het
Fras1	G	A	5: 96,614,904	G755D	probably benign	Het
Gm13078	A	T	4: 143,726,846	K175*	probably null	Het
Grid2	T	C	6: 63,909,045	Y142H	probably damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Ibtk	T	C	9: 85,726,731	Q376R	probably damaging	Het
Impdh2	T	C	9: 108,564,956	M414T	probably damaging	Het
Itm2c	A	G	1: 85,907,029	T160A	probably damaging	Het
Kcna2	T	A	3: 107,105,193	D363E	probably benign	Het
Lama2	C	T	10: 27,347,054	C412Y	probably damaging	Het
Lims2	C	G	18: 31,956,337	T151S	probably benign	Het
Mier1	T	C	4: 103,162,431	S423P	possibly damaging	Het
Mrgpra3	A	T	7: 47,589,432	W249R	probably benign	Het
Mtor	A	G	4: 148,550,152	H2410R	probably benign	Het
Mvp	C	T	7: 126,989,703	A631T	probably benign	Het
Nepro	T	C	16: 44,735,829	V450A	possibly damaging	Het
Ngrn	T	C	7: 80,264,521	V140A	probably damaging	Het
Nobox	T	C	6: 43,306,008	E231G	probably benign	Het
Olfr129	A	T	17: 38,055,272	I98N	probably damaging	Het
P3h2	T	A	16: 26,105,221	I155F	probably benign	Het
Pcdha3	C	T	18: 36,948,091	R629C	probably damaging	Het
Riok3	AGAAGCGG	AG	18: 12,135,941		probably benign	Het
Rttn	T	C	18: 89,091,896	I1675T	probably benign	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Slc35f4	G	T	14: 49,304,301	T182N	possibly damaging	Het
Slc52a3	T	A	2: 152,005,740	I256N	possibly damaging	Het
Sox9	T	C	11: 112,785,154	S390P	possibly damaging	Het
Tango2	T	C	16: 18,302,790		probably benign	Het
Tas1r1	T	C	4: 152,032,157	E340G	possibly damaging	Het
Tek	G	A	4: 94,829,970	G524R	probably damaging	Het
Tmem260	A	T	14: 48,505,304	Y532F	probably benign	Het
Tsks	C	A	7: 44,957,929	L559I	probably damaging	Het
Unc79	C	A	12: 103,122,353	L1702I	probably damaging	Het
Vmn1r14	T	A	6: 57,234,148	I237N	probably damaging	Het
Vmn2r17	G	A	5: 109,452,966	C710Y	probably benign	Het
Zfp119b	G	T	17: 55,938,926	T420K	possibly damaging	Het
Zfp202	C	T	9: 40,207,494	R68*	probably null	Het
Zfp229	T	A	17: 21,746,821	S677R	probably benign	Het
Zfp462	C	T	4: 55,008,411	H126Y	probably benign	Het
Zfp52	C	A	17: 21,560,197	Y102*	probably null	Het
Zfp616	T	A	11: 74,083,700	M265K	probably benign	Het
Zfyve9	A	T	4: 108,680,976	I1031N	probably damaging	Het
Zmynd11	T	C	13: 9,697,690	Y203C	probably damaging	Het

Other mutations in Arap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Arap2	APN	5	62635962	missense	probably damaging	1.00
IGL00642:Arap2	APN	5	62733058	nonsense	probably null
IGL00705:Arap2	APN	5	62678023	missense	probably damaging	1.00
IGL00942:Arap2	APN	5	62698389	nonsense	probably null
IGL01069:Arap2	APN	5	62649856	missense	probably benign
IGL01601:Arap2	APN	5	62641342	missense	probably damaging	1.00
IGL01986:Arap2	APN	5	62621922	missense	probably damaging	1.00
IGL02032:Arap2	APN	5	62670997	missense	probably damaging	0.99
IGL02262:Arap2	APN	5	62642841	missense	probably damaging	1.00
IGL02331:Arap2	APN	5	62649682	splice site	probably benign
IGL02527:Arap2	APN	5	62749307	missense	probably benign
IGL02803:Arap2	APN	5	62749109	missense	probably benign
IGL02864:Arap2	APN	5	62677965	missense	probably damaging	1.00
IGL03078:Arap2	APN	5	62733065	splice site	probably benign
IGL03154:Arap2	APN	5	62642925	missense	probably damaging	1.00
IGL03213:Arap2	APN	5	62749095	missense	probably benign	0.00
IGL03279:Arap2	APN	5	62621910	missense	probably damaging	1.00
IGL03288:Arap2	APN	5	62604616	missense	probably benign	0.00
PIT4354001:Arap2	UTSW	5	62654049	missense	probably damaging	1.00
R0012:Arap2	UTSW	5	62683484	missense	probably damaging	1.00
R0013:Arap2	UTSW	5	62683484	missense	probably damaging	1.00
R0013:Arap2	UTSW	5	62683484	missense	probably damaging	1.00
R0166:Arap2	UTSW	5	62676018	missense	probably damaging	1.00
R0472:Arap2	UTSW	5	62706659	missense	probably damaging	1.00
R0506:Arap2	UTSW	5	62606131	missense	possibly damaging	0.87
R0551:Arap2	UTSW	5	62641323	splice site	probably null
R0607:Arap2	UTSW	5	62606131	missense	possibly damaging	0.87
R0617:Arap2	UTSW	5	62649907	splice site	probably benign
R0975:Arap2	UTSW	5	62730886	splice site	probably benign
R0976:Arap2	UTSW	5	62649884	missense	probably damaging	1.00
R1164:Arap2	UTSW	5	62683477	missense	probably damaging	1.00
R1268:Arap2	UTSW	5	62730621	missense	probably benign	0.00
R1480:Arap2	UTSW	5	62669129	nonsense	probably null
R1502:Arap2	UTSW	5	62604404	missense	probably benign	0.00
R1543:Arap2	UTSW	5	62606155	nonsense	probably null
R1865:Arap2	UTSW	5	62698263	missense	probably damaging	0.97
R1962:Arap2	UTSW	5	62676664	missense	possibly damaging	0.82
R2040:Arap2	UTSW	5	62748916	missense	probably damaging	0.99
R2118:Arap2	UTSW	5	62706685	missense	probably damaging	1.00
R2131:Arap2	UTSW	5	62677958	missense	probably damaging	1.00
R2201:Arap2	UTSW	5	62706685	missense	probably damaging	1.00
R2215:Arap2	UTSW	5	62677176	missense	probably damaging	1.00
R3027:Arap2	UTSW	5	62669897	missense	probably damaging	1.00
R3053:Arap2	UTSW	5	62748857	missense	probably benign	0.35
R3975:Arap2	UTSW	5	62748894	missense	possibly damaging	0.87
R4272:Arap2	UTSW	5	62670979	missense	possibly damaging	0.63
R4326:Arap2	UTSW	5	62621863	missense	possibly damaging	0.50
R4327:Arap2	UTSW	5	62621863	missense	possibly damaging	0.50
R4328:Arap2	UTSW	5	62621863	missense	possibly damaging	0.50
R4451:Arap2	UTSW	5	62749170	missense	probably benign	0.06
R4659:Arap2	UTSW	5	62654126	missense	possibly damaging	0.94
R4665:Arap2	UTSW	5	62669969	missense	possibly damaging	0.95
R4715:Arap2	UTSW	5	62749094	missense	probably benign	0.43
R4808:Arap2	UTSW	5	62730641	missense	probably benign	0.23
R4941:Arap2	UTSW	5	62749478	missense	probably benign	0.20
R4983:Arap2	UTSW	5	62676525	missense	probably damaging	0.98
R5095:Arap2	UTSW	5	62654049	missense	probably damaging	1.00
R5156:Arap2	UTSW	5	62669181	nonsense	probably null
R5201:Arap2	UTSW	5	62683489	missense	probably damaging	1.00
R5346:Arap2	UTSW	5	62714746	missense	probably benign	0.39
R5359:Arap2	UTSW	5	62683419	nonsense	probably null
R5426:Arap2	UTSW	5	62642816	missense	probably benign	0.02
R5503:Arap2	UTSW	5	62630186	missense	probably damaging	1.00
R5605:Arap2	UTSW	5	62615067	missense	possibly damaging	0.47
R5764:Arap2	UTSW	5	62642854	missense	probably damaging	1.00
R5813:Arap2	UTSW	5	62677163	missense	probably damaging	1.00
R5846:Arap2	UTSW	5	62649773	missense	probably damaging	1.00
R6084:Arap2	UTSW	5	62670954	missense	possibly damaging	0.89
R6173:Arap2	UTSW	5	62749622	missense	probably damaging	1.00
R6175:Arap2	UTSW	5	62714731	critical splice donor site	probably null
R6249:Arap2	UTSW	5	62646193	missense	probably damaging	0.99
R6386:Arap2	UTSW	5	62604522	missense	possibly damaging	0.89
R6424:Arap2	UTSW	5	62683364	missense	probably damaging	1.00
R6744:Arap2	UTSW	5	62748938	missense	probably damaging	1.00
R6766:Arap2	UTSW	5	62677100	critical splice donor site	probably null
R6990:Arap2	UTSW	5	62676517	missense	probably damaging	0.96
R7067:Arap2	UTSW	5	62654044	critical splice donor site	probably null
R7098:Arap2	UTSW	5	62675950	critical splice donor site	probably null
R7107:Arap2	UTSW	5	62606208	missense	probably damaging	0.98
R7156:Arap2	UTSW	5	62604571	missense	probably damaging	1.00
R7174:Arap2	UTSW	5	62604278	missense	probably benign
R7187:Arap2	UTSW	5	62669053	missense	probably damaging	0.99
R7197:Arap2	UTSW	5	62641386	missense	possibly damaging	0.89
R7214:Arap2	UTSW	5	62749338	missense	probably benign	0.00
R7317:Arap2	UTSW	5	62649724	missense	probably damaging	1.00
R7392:Arap2	UTSW	5	62698385	missense	possibly damaging	0.54
R7438:Arap2	UTSW	5	62749475	missense	probably damaging	0.99
R7452:Arap2	UTSW	5	62676549	missense	probably benign	0.00
R7495:Arap2	UTSW	5	62676550	missense	possibly damaging	0.78
R7796:Arap2	UTSW	5	62730762	missense	probably damaging	1.00
R7936:Arap2	UTSW	5	62730705	missense	probably damaging	0.96
R8116:Arap2	UTSW	5	62730611	missense	probably benign	0.00
R8172:Arap2	UTSW	5	62621981	splice site	probably null
R8277:Arap2	UTSW	5	62613992	critical splice donor site	probably null
R8369:Arap2	UTSW	5	62604326	nonsense	probably null
R8398:Arap2	UTSW	5	62748909	missense	probably damaging	1.00
R8893:Arap2	UTSW	5	62730694	missense	probably damaging	1.00
R8973:Arap2	UTSW	5	62698325	nonsense	probably null
R9102:Arap2	UTSW	5	62748998	missense	probably benign	0.03
R9121:Arap2	UTSW	5	62748983	missense	possibly damaging	0.84
R9174:Arap2	UTSW	5	62698263	missense	probably damaging	1.00
R9222:Arap2	UTSW	5	62671078	missense	possibly damaging	0.96
R9281:Arap2	UTSW	5	62749505	missense	probably damaging	0.97
R9399:Arap2	UTSW	5	62606112	missense	possibly damaging	0.62
R9450:Arap2	UTSW	5	62698419	missense	probably benign	0.16
R9467:Arap2	UTSW	5	62730557	missense	probably benign	0.00
R9567:Arap2	UTSW	5	62604498	missense	probably benign	0.01
R9577:Arap2	UTSW	5	62611717	missense	probably damaging	1.00
R9626:Arap2	UTSW	5	62749535	missense	probably benign	0.00
R9688:Arap2	UTSW	5	62714766	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AAGTACGTTTTAGAGAATGTCCTGTGG -3'
(R):5'- TTACTTGAATGCAGTCGTGATG -3'

Sequencing Primer
(F):5'- TAGAGAATGTCCTGTGGAGATTAC -3'
(R):5'- GAATGCAGTCGTGATGTTCTTAATAG -3'

Posted On

2015-06-20