Mutagenetix > Incidental Mutation

Incidental Mutation 'R4273:Fcer2a'

322277

Institutional Source

Beutler Lab

Gene Symbol

Fcer2a

Ensembl Gene

ENSMUSG00000005540

Gene Name

Fc receptor, IgE, low affinity II, alpha polypeptide

Synonyms

Ly-42, FC epsilon RII, CD23, Fce2, low-affinity IgE receptor

MMRRC Submission

041645-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4273 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3681737-3694175 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 3682848 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 319 (V319L)

Ref Sequence

ENSEMBL: ENSMUSP00000146647 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005678] [ENSMUST00000044857] [ENSMUST00000207463] [ENSMUST00000207635] [ENSMUST00000207787] [ENSMUST00000208145] [ENSMUST00000208438] [ENSMUST00000208492] [ENSMUST00000208603]

AlphaFold

P20693

Predicted Effect

probably benign
Transcript: ENSMUST00000005678
AA Change: V320L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000005678
Gene: ENSMUSG00000005540
AA Change: V320L

Domain	Start	End	E-Value	Type
transmembrane domain	26	48	N/A	INTRINSIC
coiled coil region	80	150	N/A	INTRINSIC
CLECT	186	306	2.11e-41	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000044857

SMART Domains

Protein: ENSMUSP00000036541
Gene: ENSMUSG00000040236

Domain	Start	End	E-Value	Type
Pfam:TRAPP	28	177	3.2e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000207463
AA Change: V280L

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

probably benign
Transcript: ENSMUST00000207635
AA Change: V293L

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably benign
Transcript: ENSMUST00000207787

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208145
AA Change: V319L

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000208438
AA Change: V298L

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

probably benign
Transcript: ENSMUST00000208492
AA Change: V319L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

probably benign
Transcript: ENSMUST00000208603
AA Change: V298L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a B-cell specific antigen, and a low-affinity receptor for IgE. It has essential roles in B cell growth and differentiation, and the regulation of IgE production. This protein also exists as a soluble secreted form, then functioning as a potent mitogenic growth factor. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for mutations in this gene are essentially normal although IgE levels or IgE mediated responses may be abnormal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer2	T	A	4: 86,874,598		probably null	Het
Adgrf2	T	A	17: 42,710,122	T604S	probably damaging	Het
Akap8l	T	A	17: 32,321,931	K533*	probably null	Het
Appbp2	T	C	11: 85,234,676	Y45C	probably damaging	Het
Arap2	T	C	5: 62,670,979	I950V	possibly damaging	Het
Arhgap31	T	C	16: 38,602,335	E1123G	possibly damaging	Het
Atp2c1	G	T	9: 105,435,140	N493K	probably benign	Het
Bcr	T	C	10: 75,125,111	I458T	probably damaging	Het
Brd4	G	A	17: 32,214,782	T468I	probably benign	Het
Cdh23	T	A	10: 60,311,161	D2774V	possibly damaging	Het
Cfdp1	T	C	8: 111,768,785	Y267C	probably damaging	Het
Chd6	C	A	2: 160,961,291	A2156S	probably benign	Het
Dazap2	C	A	15: 100,618,090	P100T	probably damaging	Het
Disp1	T	A	1: 183,087,644	I1071F	possibly damaging	Het
Dlgap1	T	A	17: 70,766,043	S686T	probably benign	Het
Dst	C	T	1: 34,192,340	R3183C	possibly damaging	Het
Enpp4	T	C	17: 44,101,807	N279D	probably benign	Het
Exoc3l	T	C	8: 105,289,961	*740W	probably null	Het
Exoc5	A	T	14: 49,015,480	C625*	probably null	Het
Fam98b	A	T	2: 117,260,231	N137Y	possibly damaging	Het
Fat4	T	A	3: 38,891,627	D1556E	probably damaging	Het
Fer1l6	T	C	15: 58,627,522	V1247A	probably benign	Het
Fmo4	A	G	1: 162,805,179	V201A	probably damaging	Het
Fras1	G	A	5: 96,614,904	G755D	probably benign	Het
Gm13078	A	T	4: 143,726,846	K175*	probably null	Het
Grid2	T	C	6: 63,909,045	Y142H	probably damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Ibtk	T	C	9: 85,726,731	Q376R	probably damaging	Het
Impdh2	T	C	9: 108,564,956	M414T	probably damaging	Het
Itm2c	A	G	1: 85,907,029	T160A	probably damaging	Het
Kcna2	T	A	3: 107,105,193	D363E	probably benign	Het
Lama2	C	T	10: 27,347,054	C412Y	probably damaging	Het
Lims2	C	G	18: 31,956,337	T151S	probably benign	Het
Mier1	T	C	4: 103,162,431	S423P	possibly damaging	Het
Mrgpra3	A	T	7: 47,589,432	W249R	probably benign	Het
Mtor	A	G	4: 148,550,152	H2410R	probably benign	Het
Mvp	C	T	7: 126,989,703	A631T	probably benign	Het
Nepro	T	C	16: 44,735,829	V450A	possibly damaging	Het
Ngrn	T	C	7: 80,264,521	V140A	probably damaging	Het
Nobox	T	C	6: 43,306,008	E231G	probably benign	Het
Olfr129	A	T	17: 38,055,272	I98N	probably damaging	Het
P3h2	T	A	16: 26,105,221	I155F	probably benign	Het
Pcdha3	C	T	18: 36,948,091	R629C	probably damaging	Het
Riok3	AGAAGCGG	AG	18: 12,135,941		probably benign	Het
Rttn	T	C	18: 89,091,896	I1675T	probably benign	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Slc35f4	G	T	14: 49,304,301	T182N	possibly damaging	Het
Slc52a3	T	A	2: 152,005,740	I256N	possibly damaging	Het
Sox9	T	C	11: 112,785,154	S390P	possibly damaging	Het
Tango2	T	C	16: 18,302,790		probably benign	Het
Tas1r1	T	C	4: 152,032,157	E340G	possibly damaging	Het
Tek	G	A	4: 94,829,970	G524R	probably damaging	Het
Tmem260	A	T	14: 48,505,304	Y532F	probably benign	Het
Tsks	C	A	7: 44,957,929	L559I	probably damaging	Het
Unc79	C	A	12: 103,122,353	L1702I	probably damaging	Het
Vmn1r14	T	A	6: 57,234,148	I237N	probably damaging	Het
Vmn2r17	G	A	5: 109,452,966	C710Y	probably benign	Het
Zfp119b	G	T	17: 55,938,926	T420K	possibly damaging	Het
Zfp202	C	T	9: 40,207,494	R68*	probably null	Het
Zfp229	T	A	17: 21,746,821	S677R	probably benign	Het
Zfp462	C	T	4: 55,008,411	H126Y	probably benign	Het
Zfp52	C	A	17: 21,560,197	Y102*	probably null	Het
Zfp616	T	A	11: 74,083,700	M265K	probably benign	Het
Zfyve9	A	T	4: 108,680,976	I1031N	probably damaging	Het
Zmynd11	T	C	13: 9,697,690	Y203C	probably damaging	Het

Other mutations in Fcer2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Fcer2a	APN	8	3688842	missense	possibly damaging	0.94
IGL01458:Fcer2a	APN	8	3688151	missense	probably benign	0.45
IGL01545:Fcer2a	APN	8	3683598	nonsense	probably null
IGL01994:Fcer2a	APN	8	3688302	missense	possibly damaging	0.94
IGL03340:Fcer2a	APN	8	3688310	missense	possibly damaging	0.75
anemone	UTSW	8	3688796	critical splice donor site	probably null
R0058:Fcer2a	UTSW	8	3688111	splice site	probably benign
R0058:Fcer2a	UTSW	8	3688111	splice site	probably benign
R0241:Fcer2a	UTSW	8	3688796	critical splice donor site	probably null
R0241:Fcer2a	UTSW	8	3688796	critical splice donor site	probably null
R0276:Fcer2a	UTSW	8	3689811	missense	possibly damaging	0.89
R1530:Fcer2a	UTSW	8	3682976	missense	probably damaging	0.98
R2202:Fcer2a	UTSW	8	3688557	missense	possibly damaging	0.72
R4133:Fcer2a	UTSW	8	3691130	missense	possibly damaging	0.60
R4249:Fcer2a	UTSW	8	3688831	missense	probably benign	0.00
R4506:Fcer2a	UTSW	8	3688603	splice site	probably null
R6796:Fcer2a	UTSW	8	3689830	missense	possibly damaging	0.92
R6861:Fcer2a	UTSW	8	3682910	missense	probably damaging	0.98
R7421:Fcer2a	UTSW	8	3690335	missense	probably benign
R7795:Fcer2a	UTSW	8	3682910	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCTTCAGTATGGGTGGGAAC -3'
(R):5'- AGATCCCCAAAGGTGCAATCG -3'

Sequencing Primer
(F):5'- CTTCAGTATGGGTGGGAACATAATC -3'
(R):5'- AATCACATCCTTTGACTGGGG -3'

Posted On

2015-06-20