Incidental Mutation 'R4273:Exoc3l'
ID 322278
Institutional Source Beutler Lab
Gene Symbol Exoc3l
Ensembl Gene ENSMUSG00000043251
Gene Name exocyst complex component 3-like
Synonyms C730015A04Rik
MMRRC Submission 041645-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.248) question?
Stock # R4273 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 106016556-106022733 bp(-) (GRCm39)
Type of Mutation makesense
DNA Base Change (assembly) T to C at 106016593 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Stop codon to Tryptophan at position 740 (*740W)
Ref Sequence ENSEMBL: ENSMUSP00000053766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014981] [ENSMUST00000057855] [ENSMUST00000171788] [ENSMUST00000212219] [ENSMUST00000212777] [ENSMUST00000212922]
AlphaFold Q8BI71
Predicted Effect probably benign
Transcript: ENSMUST00000014981
SMART Domains Protein: ENSMUSP00000014981
Gene: ENSMUSG00000014837

DomainStartEndE-ValueType
DUF1704 148 457 1.07e-139 SMART
Predicted Effect probably null
Transcript: ENSMUST00000057855
AA Change: *740W
SMART Domains Protein: ENSMUSP00000053766
Gene: ENSMUSG00000043251
AA Change: *740W

DomainStartEndE-ValueType
Pfam:Sec6 189 722 5.4e-116 PFAM
low complexity region 723 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171788
SMART Domains Protein: ENSMUSP00000128530
Gene: ENSMUSG00000014837

DomainStartEndE-ValueType
DUF1704 148 457 1.07e-139 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212215
Predicted Effect probably benign
Transcript: ENSMUST00000212219
Predicted Effect probably benign
Transcript: ENSMUST00000212777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212359
Predicted Effect probably benign
Transcript: ENSMUST00000212922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212288
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,792,835 (GRCm39) probably null Het
Adgrf2 T A 17: 43,021,013 (GRCm39) T604S probably damaging Het
Akap8l T A 17: 32,540,905 (GRCm39) K533* probably null Het
Appbp2 T C 11: 85,125,502 (GRCm39) Y45C probably damaging Het
Arap2 T C 5: 62,828,322 (GRCm39) I950V possibly damaging Het
Arhgap31 T C 16: 38,422,697 (GRCm39) E1123G possibly damaging Het
Atp2c1 G T 9: 105,312,339 (GRCm39) N493K probably benign Het
Bcr T C 10: 74,960,943 (GRCm39) I458T probably damaging Het
Brd4 G A 17: 32,433,756 (GRCm39) T468I probably benign Het
Cdh23 T A 10: 60,146,940 (GRCm39) D2774V possibly damaging Het
Cfdp1 T C 8: 112,495,417 (GRCm39) Y267C probably damaging Het
Chd6 C A 2: 160,803,211 (GRCm39) A2156S probably benign Het
Dazap2 C A 15: 100,515,971 (GRCm39) P100T probably damaging Het
Disp1 T A 1: 182,869,208 (GRCm39) I1071F possibly damaging Het
Dlgap1 T A 17: 71,073,038 (GRCm39) S686T probably benign Het
Dst C T 1: 34,231,421 (GRCm39) R3183C possibly damaging Het
Enpp4 T C 17: 44,412,698 (GRCm39) N279D probably benign Het
Exoc5 A T 14: 49,252,937 (GRCm39) C625* probably null Het
Fam98b A T 2: 117,090,712 (GRCm39) N137Y possibly damaging Het
Fat4 T A 3: 38,945,776 (GRCm39) D1556E probably damaging Het
Fcer2a C A 8: 3,732,848 (GRCm39) V319L possibly damaging Het
Fer1l6 T C 15: 58,499,371 (GRCm39) V1247A probably benign Het
Fmo4 A G 1: 162,632,748 (GRCm39) V201A probably damaging Het
Fras1 G A 5: 96,762,763 (GRCm39) G755D probably benign Het
Grid2 T C 6: 63,886,029 (GRCm39) Y142H probably damaging Het
Hspg2 C T 4: 137,246,251 (GRCm39) R1010C probably damaging Het
Ibtk T C 9: 85,608,784 (GRCm39) Q376R probably damaging Het
Impdh2 T C 9: 108,442,155 (GRCm39) M414T probably damaging Het
Itm2c A G 1: 85,834,750 (GRCm39) T160A probably damaging Het
Kcna2 T A 3: 107,012,509 (GRCm39) D363E probably benign Het
Lama2 C T 10: 27,223,050 (GRCm39) C412Y probably damaging Het
Lims2 C G 18: 32,089,390 (GRCm39) T151S probably benign Het
Mier1 T C 4: 103,019,628 (GRCm39) S423P possibly damaging Het
Mrgpra3 A T 7: 47,239,180 (GRCm39) W249R probably benign Het
Mtor A G 4: 148,634,609 (GRCm39) H2410R probably benign Het
Mvp C T 7: 126,588,875 (GRCm39) A631T probably benign Het
Nepro T C 16: 44,556,192 (GRCm39) V450A possibly damaging Het
Ngrn T C 7: 79,914,269 (GRCm39) V140A probably damaging Het
Nobox T C 6: 43,282,942 (GRCm39) E231G probably benign Het
Or10al7 A T 17: 38,366,163 (GRCm39) I98N probably damaging Het
P3h2 T A 16: 25,923,971 (GRCm39) I155F probably benign Het
Pcdha3 C T 18: 37,081,144 (GRCm39) R629C probably damaging Het
Pramel24 A T 4: 143,453,416 (GRCm39) K175* probably null Het
Riok3 AGAAGCGG AG 18: 12,268,998 (GRCm39) probably benign Het
Rttn T C 18: 89,110,020 (GRCm39) I1675T probably benign Het
Sall2 C A 14: 52,551,260 (GRCm39) R643L probably damaging Het
Slc35f4 G T 14: 49,541,758 (GRCm39) T182N possibly damaging Het
Slc52a3 T A 2: 151,847,660 (GRCm39) I256N possibly damaging Het
Sox9 T C 11: 112,675,980 (GRCm39) S390P possibly damaging Het
Tango2 T C 16: 18,120,654 (GRCm39) probably benign Het
Tas1r1 T C 4: 152,116,614 (GRCm39) E340G possibly damaging Het
Tek G A 4: 94,718,207 (GRCm39) G524R probably damaging Het
Tmem260 A T 14: 48,742,761 (GRCm39) Y532F probably benign Het
Tsks C A 7: 44,607,353 (GRCm39) L559I probably damaging Het
Unc79 C A 12: 103,088,612 (GRCm39) L1702I probably damaging Het
Vmn1r14 T A 6: 57,211,133 (GRCm39) I237N probably damaging Het
Vmn2r17 G A 5: 109,600,832 (GRCm39) C710Y probably benign Het
Zfp119b G T 17: 56,245,926 (GRCm39) T420K possibly damaging Het
Zfp202 C T 9: 40,118,790 (GRCm39) R68* probably null Het
Zfp229 T A 17: 21,965,802 (GRCm39) S677R probably benign Het
Zfp462 C T 4: 55,008,411 (GRCm39) H126Y probably benign Het
Zfp52 C A 17: 21,780,459 (GRCm39) Y102* probably null Het
Zfp616 T A 11: 73,974,526 (GRCm39) M265K probably benign Het
Zfyve9 A T 4: 108,538,173 (GRCm39) I1031N probably damaging Het
Zmynd11 T C 13: 9,747,726 (GRCm39) Y203C probably damaging Het
Other mutations in Exoc3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Exoc3l APN 8 106,017,130 (GRCm39) missense probably benign 0.25
IGL01731:Exoc3l APN 8 106,019,587 (GRCm39) missense probably benign 0.16
IGL02364:Exoc3l APN 8 106,017,209 (GRCm39) missense possibly damaging 0.71
IGL02413:Exoc3l APN 8 106,019,070 (GRCm39) missense probably damaging 1.00
IGL02512:Exoc3l APN 8 106,017,115 (GRCm39) missense probably damaging 1.00
IGL02810:Exoc3l APN 8 106,021,980 (GRCm39) missense probably damaging 1.00
R0045:Exoc3l UTSW 8 106,020,317 (GRCm39) missense probably damaging 1.00
R0045:Exoc3l UTSW 8 106,020,317 (GRCm39) missense probably damaging 1.00
R0183:Exoc3l UTSW 8 106,021,932 (GRCm39) missense probably damaging 1.00
R0302:Exoc3l UTSW 8 106,020,175 (GRCm39) missense probably benign 0.01
R1660:Exoc3l UTSW 8 106,019,692 (GRCm39) critical splice donor site probably null
R1699:Exoc3l UTSW 8 106,021,645 (GRCm39) missense probably benign 0.34
R1826:Exoc3l UTSW 8 106,020,250 (GRCm39) missense probably damaging 0.97
R2275:Exoc3l UTSW 8 106,017,079 (GRCm39) critical splice donor site probably null
R3928:Exoc3l UTSW 8 106,017,549 (GRCm39) unclassified probably benign
R3938:Exoc3l UTSW 8 106,020,037 (GRCm39) missense probably damaging 1.00
R4261:Exoc3l UTSW 8 106,017,599 (GRCm39) missense probably damaging 0.98
R5518:Exoc3l UTSW 8 106,019,795 (GRCm39) missense probably benign 0.27
R6471:Exoc3l UTSW 8 106,017,166 (GRCm39) missense probably damaging 1.00
R6511:Exoc3l UTSW 8 106,019,887 (GRCm39) missense probably benign 0.00
R6631:Exoc3l UTSW 8 106,021,993 (GRCm39) missense probably damaging 1.00
R6694:Exoc3l UTSW 8 106,017,122 (GRCm39) missense probably benign 0.15
R6843:Exoc3l UTSW 8 106,016,729 (GRCm39) missense probably benign 0.00
R7310:Exoc3l UTSW 8 106,020,340 (GRCm39) missense probably damaging 1.00
R7387:Exoc3l UTSW 8 106,021,605 (GRCm39) missense probably damaging 1.00
R7442:Exoc3l UTSW 8 106,019,558 (GRCm39) missense probably damaging 1.00
R7764:Exoc3l UTSW 8 106,017,333 (GRCm39) missense possibly damaging 0.62
R7845:Exoc3l UTSW 8 106,016,782 (GRCm39) missense probably damaging 1.00
R8748:Exoc3l UTSW 8 106,016,777 (GRCm39) missense probably damaging 0.98
R8879:Exoc3l UTSW 8 106,017,181 (GRCm39) missense
Z1176:Exoc3l UTSW 8 106,017,426 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TAGGAAGTGAGTACTCCACGGG -3'
(R):5'- TATTCCTGCAGCGAGGATCAC -3'

Sequencing Primer
(F):5'- TCCACAAAGAGAGCAGATGTCTG -3'
(R):5'- AGCGAGGATCACGTCTCTG -3'
Posted On 2015-06-20