Incidental Mutation 'R4273:Atp2c1'
ID 322280
Institutional Source Beutler Lab
Gene Symbol Atp2c1
Ensembl Gene ENSMUSG00000032570
Gene Name ATPase, Ca++-sequestering
Synonyms D930003G21Rik, SPCA, ATP2C1A, PMR1, 1700121J11Rik
MMRRC Submission 041645-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.203) question?
Stock # R4273 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 105403539-105527319 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 105435140 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 493 (N493K)
Ref Sequence ENSEMBL: ENSMUSP00000135646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038118] [ENSMUST00000085133] [ENSMUST00000112558] [ENSMUST00000163879] [ENSMUST00000176770] [ENSMUST00000177074] [ENSMUST00000177293]
AlphaFold Q80XR2
Predicted Effect probably benign
Transcript: ENSMUST00000038118
AA Change: N493K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000039103
Gene: ENSMUSG00000032570
AA Change: N493K

DomainStartEndE-ValueType
Cation_ATPase_N 25 99 1.85e-14 SMART
Pfam:E1-E2_ATPase 105 339 2.3e-75 PFAM
Pfam:Hydrolase 343 655 2.9e-31 PFAM
Pfam:HAD 346 652 7.7e-15 PFAM
Pfam:Hydrolase_like2 408 492 9.5e-20 PFAM
low complexity region 706 721 N/A INTRINSIC
Pfam:Cation_ATPase_C 725 897 4e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085133
AA Change: N527K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000082220
Gene: ENSMUSG00000032570
AA Change: N527K

DomainStartEndE-ValueType
Cation_ATPase_N 59 133 1.85e-14 SMART
Pfam:E1-E2_ATPase 138 372 3.4e-62 PFAM
Pfam:Hydrolase 377 689 2.6e-23 PFAM
Pfam:HAD 380 686 7.8e-14 PFAM
Pfam:Cation_ATPase 442 526 3.2e-19 PFAM
low complexity region 740 755 N/A INTRINSIC
Pfam:Cation_ATPase_C 759 931 3.8e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112557
Predicted Effect probably benign
Transcript: ENSMUST00000112558
AA Change: N493K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108177
Gene: ENSMUSG00000032570
AA Change: N493K

DomainStartEndE-ValueType
Cation_ATPase_N 25 99 1.85e-14 SMART
Pfam:E1-E2_ATPase 105 339 2.3e-75 PFAM
Pfam:Hydrolase 343 655 2.9e-31 PFAM
Pfam:HAD 346 652 7.7e-15 PFAM
Pfam:Hydrolase_like2 408 492 9.5e-20 PFAM
low complexity region 706 721 N/A INTRINSIC
Pfam:Cation_ATPase_C 725 897 4e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163879
AA Change: N477K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000129617
Gene: ENSMUSG00000032570
AA Change: N477K

DomainStartEndE-ValueType
Cation_ATPase_N 9 83 1.85e-14 SMART
Pfam:E1-E2_ATPase 89 323 5.2e-76 PFAM
Pfam:Hydrolase 327 639 5.6e-32 PFAM
Pfam:HAD 330 636 1.4e-15 PFAM
Pfam:Hydrolase_like2 392 476 3.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176656
Predicted Effect probably benign
Transcript: ENSMUST00000176770
AA Change: N488K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134764
Gene: ENSMUSG00000032570
AA Change: N488K

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 100 334 8.9e-76 PFAM
Pfam:Hydrolase 338 650 1.1e-31 PFAM
Pfam:HAD 341 647 2.7e-15 PFAM
Pfam:Hydrolase_like2 403 487 4.8e-20 PFAM
low complexity region 701 716 N/A INTRINSIC
Pfam:Cation_ATPase_C 720 892 1.6e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177000
Predicted Effect probably benign
Transcript: ENSMUST00000177074
AA Change: N493K

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135646
Gene: ENSMUSG00000032570
AA Change: N493K

DomainStartEndE-ValueType
Cation_ATPase_N 25 99 1.85e-14 SMART
Pfam:E1-E2_ATPase 105 339 8.2e-76 PFAM
Pfam:Hydrolase 343 655 1e-31 PFAM
Pfam:HAD 346 652 2.5e-15 PFAM
Pfam:Hydrolase_like2 408 492 4.5e-20 PFAM
low complexity region 706 721 N/A INTRINSIC
Pfam:Cation_ATPase_C 725 886 7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177293
AA Change: N357K

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000135802
Gene: ENSMUSG00000032570
AA Change: N357K

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 1 203 6.7e-64 PFAM
Pfam:Hydrolase 207 519 7.4e-32 PFAM
Pfam:HAD 210 516 1.9e-15 PFAM
Pfam:Hydrolase_like2 272 356 3.8e-20 PFAM
transmembrane domain 564 586 N/A INTRINSIC
Pfam:Cation_ATPase_C 589 761 1.2e-47 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases. This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the transport of calcium ions. Defects in this gene cause Hailey-Hailey disease, an autosomal dominant disorder. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth retardation, failure of rostral neural tube closure, Golgi and endoplasmic reticulum stress, increased apoptosis, accumulation of intracellular lipid droplets and midgestational lethality. Agedheterozygotes develop squamous cell tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,598 probably null Het
Adgrf2 T A 17: 42,710,122 T604S probably damaging Het
Akap8l T A 17: 32,321,931 K533* probably null Het
Appbp2 T C 11: 85,234,676 Y45C probably damaging Het
Arap2 T C 5: 62,670,979 I950V possibly damaging Het
Arhgap31 T C 16: 38,602,335 E1123G possibly damaging Het
Bcr T C 10: 75,125,111 I458T probably damaging Het
Brd4 G A 17: 32,214,782 T468I probably benign Het
Cdh23 T A 10: 60,311,161 D2774V possibly damaging Het
Cfdp1 T C 8: 111,768,785 Y267C probably damaging Het
Chd6 C A 2: 160,961,291 A2156S probably benign Het
Dazap2 C A 15: 100,618,090 P100T probably damaging Het
Disp1 T A 1: 183,087,644 I1071F possibly damaging Het
Dlgap1 T A 17: 70,766,043 S686T probably benign Het
Dst C T 1: 34,192,340 R3183C possibly damaging Het
Enpp4 T C 17: 44,101,807 N279D probably benign Het
Exoc3l T C 8: 105,289,961 *740W probably null Het
Exoc5 A T 14: 49,015,480 C625* probably null Het
Fam98b A T 2: 117,260,231 N137Y possibly damaging Het
Fat4 T A 3: 38,891,627 D1556E probably damaging Het
Fcer2a C A 8: 3,682,848 V319L possibly damaging Het
Fer1l6 T C 15: 58,627,522 V1247A probably benign Het
Fmo4 A G 1: 162,805,179 V201A probably damaging Het
Fras1 G A 5: 96,614,904 G755D probably benign Het
Gm13078 A T 4: 143,726,846 K175* probably null Het
Grid2 T C 6: 63,909,045 Y142H probably damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ibtk T C 9: 85,726,731 Q376R probably damaging Het
Impdh2 T C 9: 108,564,956 M414T probably damaging Het
Itm2c A G 1: 85,907,029 T160A probably damaging Het
Kcna2 T A 3: 107,105,193 D363E probably benign Het
Lama2 C T 10: 27,347,054 C412Y probably damaging Het
Lims2 C G 18: 31,956,337 T151S probably benign Het
Mier1 T C 4: 103,162,431 S423P possibly damaging Het
Mrgpra3 A T 7: 47,589,432 W249R probably benign Het
Mtor A G 4: 148,550,152 H2410R probably benign Het
Mvp C T 7: 126,989,703 A631T probably benign Het
Nepro T C 16: 44,735,829 V450A possibly damaging Het
Ngrn T C 7: 80,264,521 V140A probably damaging Het
Nobox T C 6: 43,306,008 E231G probably benign Het
Olfr129 A T 17: 38,055,272 I98N probably damaging Het
P3h2 T A 16: 26,105,221 I155F probably benign Het
Pcdha3 C T 18: 36,948,091 R629C probably damaging Het
Riok3 AGAAGCGG AG 18: 12,135,941 probably benign Het
Rttn T C 18: 89,091,896 I1675T probably benign Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Slc35f4 G T 14: 49,304,301 T182N possibly damaging Het
Slc52a3 T A 2: 152,005,740 I256N possibly damaging Het
Sox9 T C 11: 112,785,154 S390P possibly damaging Het
Tango2 T C 16: 18,302,790 probably benign Het
Tas1r1 T C 4: 152,032,157 E340G possibly damaging Het
Tek G A 4: 94,829,970 G524R probably damaging Het
Tmem260 A T 14: 48,505,304 Y532F probably benign Het
Tsks C A 7: 44,957,929 L559I probably damaging Het
Unc79 C A 12: 103,122,353 L1702I probably damaging Het
Vmn1r14 T A 6: 57,234,148 I237N probably damaging Het
Vmn2r17 G A 5: 109,452,966 C710Y probably benign Het
Zfp119b G T 17: 55,938,926 T420K possibly damaging Het
Zfp202 C T 9: 40,207,494 R68* probably null Het
Zfp229 T A 17: 21,746,821 S677R probably benign Het
Zfp462 C T 4: 55,008,411 H126Y probably benign Het
Zfp52 C A 17: 21,560,197 Y102* probably null Het
Zfp616 T A 11: 74,083,700 M265K probably benign Het
Zfyve9 A T 4: 108,680,976 I1031N probably damaging Het
Zmynd11 T C 13: 9,697,690 Y203C probably damaging Het
Other mutations in Atp2c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Atp2c1 APN 9 105418579 missense probably damaging 1.00
IGL01682:Atp2c1 APN 9 105452842 missense probably damaging 1.00
IGL01874:Atp2c1 APN 9 105448825 missense probably damaging 1.00
IGL02299:Atp2c1 APN 9 105461087 unclassified probably benign
IGL03186:Atp2c1 APN 9 105413130 missense probably benign 0.10
IGL03212:Atp2c1 APN 9 105445267 missense probably damaging 1.00
BB002:Atp2c1 UTSW 9 105442770 missense possibly damaging 0.92
BB012:Atp2c1 UTSW 9 105442770 missense possibly damaging 0.92
IGL02799:Atp2c1 UTSW 9 105413043 unclassified probably benign
IGL03047:Atp2c1 UTSW 9 105521007 intron probably benign
R0885:Atp2c1 UTSW 9 105421573 critical splice donor site probably null
R1072:Atp2c1 UTSW 9 105459744 missense possibly damaging 0.92
R1469:Atp2c1 UTSW 9 105435152 nonsense probably null
R1469:Atp2c1 UTSW 9 105435152 nonsense probably null
R1611:Atp2c1 UTSW 9 105442852 missense probably damaging 0.98
R1638:Atp2c1 UTSW 9 105432698 missense probably damaging 0.96
R1667:Atp2c1 UTSW 9 105432797 missense probably null 0.94
R1722:Atp2c1 UTSW 9 105439400 missense probably benign 0.01
R1734:Atp2c1 UTSW 9 105414655 missense probably damaging 1.00
R1782:Atp2c1 UTSW 9 105431587 missense probably damaging 0.99
R1964:Atp2c1 UTSW 9 105446123 missense probably damaging 1.00
R2008:Atp2c1 UTSW 9 105432726 missense probably benign 0.00
R2093:Atp2c1 UTSW 9 105418121 nonsense probably null
R3720:Atp2c1 UTSW 9 105422976 missense probably damaging 1.00
R4118:Atp2c1 UTSW 9 105466659 missense probably damaging 1.00
R4763:Atp2c1 UTSW 9 105418567 missense probably damaging 1.00
R4962:Atp2c1 UTSW 9 105442950 missense probably benign 0.03
R5121:Atp2c1 UTSW 9 105448825 missense probably damaging 1.00
R5458:Atp2c1 UTSW 9 105414725 nonsense probably null
R5551:Atp2c1 UTSW 9 105459737 missense probably damaging 1.00
R6198:Atp2c1 UTSW 9 105521072 missense probably benign 0.00
R6414:Atp2c1 UTSW 9 105466656 missense probably damaging 1.00
R6432:Atp2c1 UTSW 9 105445313 missense probably damaging 1.00
R6675:Atp2c1 UTSW 9 105453533 critical splice donor site probably null
R6719:Atp2c1 UTSW 9 105424178 missense probably damaging 1.00
R6777:Atp2c1 UTSW 9 105418600 missense possibly damaging 0.64
R6847:Atp2c1 UTSW 9 105418579 missense probably damaging 1.00
R6870:Atp2c1 UTSW 9 105470062 missense probably benign 0.13
R7097:Atp2c1 UTSW 9 105464651 missense probably damaging 1.00
R7120:Atp2c1 UTSW 9 105420186 nonsense probably null
R7216:Atp2c1 UTSW 9 105467731 missense probably benign 0.00
R7284:Atp2c1 UTSW 9 105520809 splice site probably null
R7365:Atp2c1 UTSW 9 105422999 missense probably damaging 1.00
R7448:Atp2c1 UTSW 9 105452783 missense probably damaging 0.98
R7818:Atp2c1 UTSW 9 105414757 missense probably benign 0.06
R7921:Atp2c1 UTSW 9 105414687 missense probably damaging 1.00
R7925:Atp2c1 UTSW 9 105442770 missense possibly damaging 0.92
R8088:Atp2c1 UTSW 9 105452569 splice site probably null
R8257:Atp2c1 UTSW 9 105431557 missense probably benign 0.40
R8260:Atp2c1 UTSW 9 105418579 missense probably damaging 1.00
R8265:Atp2c1 UTSW 9 105470116 missense probably benign 0.01
R8307:Atp2c1 UTSW 9 105442831 missense probably benign
R9052:Atp2c1 UTSW 9 105452833 missense probably damaging 0.99
R9066:Atp2c1 UTSW 9 105453646 missense probably damaging 1.00
R9177:Atp2c1 UTSW 9 105459659 critical splice donor site probably null
R9257:Atp2c1 UTSW 9 105414652 nonsense probably null
R9566:Atp2c1 UTSW 9 105466629 missense probably damaging 0.97
R9779:Atp2c1 UTSW 9 105414720 missense probably damaging 0.98
X0053:Atp2c1 UTSW 9 105418684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCAGGAGTTCTGATGTCTGG -3'
(R):5'- TGTGCCACTCAAAGCATTGG -3'

Sequencing Primer
(F):5'- GGTAGAGTCGGACACTTCAC -3'
(R):5'- GCATTGGGCTTGAATAACTTTGTAAG -3'
Posted On 2015-06-20