Incidental Mutation 'R4273:Zfp616'
ID322285
Institutional Source Beutler Lab
Gene Symbol Zfp616
Ensembl Gene ENSMUSG00000069476
Gene Namezinc finger protein 616
SynonymsGm12330
MMRRC Submission 041645-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4273 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location74069955-74087292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74083700 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 265 (M265K)
Ref Sequence ENSEMBL: ENSMUSP00000136549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074813] [ENSMUST00000108463] [ENSMUST00000116546] [ENSMUST00000178159]
Predicted Effect probably benign
Transcript: ENSMUST00000074813
SMART Domains Protein: ENSMUSP00000074365
Gene: ENSMUSG00000069476

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108463
AA Change: M356K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104103
Gene: ENSMUSG00000069476
AA Change: M356K

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
low complexity region 249 258 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116546
SMART Domains Protein: ENSMUSP00000112245
Gene: ENSMUSG00000069476

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137407
Predicted Effect probably benign
Transcript: ENSMUST00000178159
AA Change: M265K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136549
Gene: ENSMUSG00000069476
AA Change: M265K

DomainStartEndE-ValueType
internal_repeat_1 125 447 7.61e-6 PROSPERO
ZnF_C2H2 452 474 3.11e-2 SMART
ZnF_C2H2 509 531 2.61e-4 SMART
ZnF_C2H2 537 559 1.47e-3 SMART
ZnF_C2H2 565 587 5.21e-4 SMART
ZnF_C2H2 593 615 1.22e-4 SMART
ZnF_C2H2 621 643 2.57e-3 SMART
ZnF_C2H2 649 671 9.22e-5 SMART
ZnF_C2H2 677 699 5.9e-3 SMART
ZnF_C2H2 705 727 4.94e-5 SMART
ZnF_C2H2 733 755 8.34e-3 SMART
ZnF_C2H2 761 783 1.6e-4 SMART
ZnF_C2H2 789 811 6.88e-4 SMART
ZnF_C2H2 817 839 1.6e-4 SMART
ZnF_C2H2 845 867 1.3e-4 SMART
ZnF_C2H2 873 895 7.37e-4 SMART
ZnF_C2H2 901 923 1.6e-4 SMART
ZnF_C2H2 929 951 1.3e-4 SMART
ZnF_C2H2 957 979 3.95e-4 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,598 probably null Het
Adgrf2 T A 17: 42,710,122 T604S probably damaging Het
Akap8l T A 17: 32,321,931 K533* probably null Het
Appbp2 T C 11: 85,234,676 Y45C probably damaging Het
Arap2 T C 5: 62,670,979 I950V possibly damaging Het
Arhgap31 T C 16: 38,602,335 E1123G possibly damaging Het
Atp2c1 G T 9: 105,435,140 N493K probably benign Het
Bcr T C 10: 75,125,111 I458T probably damaging Het
Brd4 G A 17: 32,214,782 T468I probably benign Het
Cdh23 T A 10: 60,311,161 D2774V possibly damaging Het
Cfdp1 T C 8: 111,768,785 Y267C probably damaging Het
Chd6 C A 2: 160,961,291 A2156S probably benign Het
Dazap2 C A 15: 100,618,090 P100T probably damaging Het
Disp1 T A 1: 183,087,644 I1071F possibly damaging Het
Dlgap1 T A 17: 70,766,043 S686T probably benign Het
Dst C T 1: 34,192,340 R3183C possibly damaging Het
Enpp4 T C 17: 44,101,807 N279D probably benign Het
Exoc3l T C 8: 105,289,961 *740W probably null Het
Exoc5 A T 14: 49,015,480 C625* probably null Het
Fam98b A T 2: 117,260,231 N137Y possibly damaging Het
Fat4 T A 3: 38,891,627 D1556E probably damaging Het
Fcer2a C A 8: 3,682,848 V319L possibly damaging Het
Fer1l6 T C 15: 58,627,522 V1247A probably benign Het
Fmo4 A G 1: 162,805,179 V201A probably damaging Het
Fras1 G A 5: 96,614,904 G755D probably benign Het
Gm13078 A T 4: 143,726,846 K175* probably null Het
Grid2 T C 6: 63,909,045 Y142H probably damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ibtk T C 9: 85,726,731 Q376R probably damaging Het
Impdh2 T C 9: 108,564,956 M414T probably damaging Het
Itm2c A G 1: 85,907,029 T160A probably damaging Het
Kcna2 T A 3: 107,105,193 D363E probably benign Het
Lama2 C T 10: 27,347,054 C412Y probably damaging Het
Lims2 C G 18: 31,956,337 T151S probably benign Het
Mier1 T C 4: 103,162,431 S423P possibly damaging Het
Mrgpra3 A T 7: 47,589,432 W249R probably benign Het
Mtor A G 4: 148,550,152 H2410R probably benign Het
Mvp C T 7: 126,989,703 A631T probably benign Het
Nepro T C 16: 44,735,829 V450A possibly damaging Het
Ngrn T C 7: 80,264,521 V140A probably damaging Het
Nobox T C 6: 43,306,008 E231G probably benign Het
Olfr129 A T 17: 38,055,272 I98N probably damaging Het
P3h2 T A 16: 26,105,221 I155F probably benign Het
Pcdha3 C T 18: 36,948,091 R629C probably damaging Het
Riok3 AGAAGCGG AG 18: 12,135,941 probably benign Het
Rttn T C 18: 89,091,896 I1675T probably benign Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Slc35f4 G T 14: 49,304,301 T182N possibly damaging Het
Slc52a3 T A 2: 152,005,740 I256N possibly damaging Het
Sox9 T C 11: 112,785,154 S390P possibly damaging Het
Tango2 T C 16: 18,302,790 probably benign Het
Tas1r1 T C 4: 152,032,157 E340G possibly damaging Het
Tek G A 4: 94,829,970 G524R probably damaging Het
Tmem260 A T 14: 48,505,304 Y532F probably benign Het
Tsks C A 7: 44,957,929 L559I probably damaging Het
Unc79 C A 12: 103,122,353 L1702I probably damaging Het
Vmn1r14 T A 6: 57,234,148 I237N probably damaging Het
Vmn2r17 G A 5: 109,452,966 C710Y probably benign Het
Zfp119b G T 17: 55,938,926 T420K possibly damaging Het
Zfp202 C T 9: 40,207,494 R68* probably null Het
Zfp229 T A 17: 21,746,821 S677R probably benign Het
Zfp462 C T 4: 55,008,411 H126Y probably benign Het
Zfp52 C A 17: 21,560,197 Y102* probably null Het
Zfyve9 A T 4: 108,680,976 I1031N probably damaging Het
Zmynd11 T C 13: 9,697,690 Y203C probably damaging Het
Other mutations in Zfp616
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Zfp616 APN 11 74083613 missense probably damaging 0.98
IGL00570:Zfp616 APN 11 74085805 missense probably benign 0.03
IGL00594:Zfp616 APN 11 74082963 missense possibly damaging 0.72
IGL01861:Zfp616 APN 11 74082916 missense possibly damaging 0.53
IGL03022:Zfp616 APN 11 74082974 missense possibly damaging 0.85
R0197:Zfp616 UTSW 11 74085674 missense probably damaging 1.00
R0442:Zfp616 UTSW 11 74084495 missense possibly damaging 0.92
R0497:Zfp616 UTSW 11 74083480 missense probably benign 0.00
R0651:Zfp616 UTSW 11 74083729 nonsense probably null
R0730:Zfp616 UTSW 11 74084822 missense probably damaging 1.00
R0883:Zfp616 UTSW 11 74085674 missense probably damaging 1.00
R0926:Zfp616 UTSW 11 74085818 missense probably benign 0.04
R0940:Zfp616 UTSW 11 74085024 missense probably damaging 1.00
R1068:Zfp616 UTSW 11 74082941 makesense probably null
R1272:Zfp616 UTSW 11 74085236 missense probably benign 0.08
R1446:Zfp616 UTSW 11 74083238 unclassified probably null
R1482:Zfp616 UTSW 11 74083977 missense possibly damaging 0.72
R1553:Zfp616 UTSW 11 74083918 missense possibly damaging 0.53
R1564:Zfp616 UTSW 11 74084722 missense probably damaging 1.00
R1728:Zfp616 UTSW 11 74085771 missense probably damaging 0.99
R1796:Zfp616 UTSW 11 74085845 missense probably damaging 0.98
R1797:Zfp616 UTSW 11 74085279 nonsense probably null
R1993:Zfp616 UTSW 11 74084969 missense probably benign 0.08
R2026:Zfp616 UTSW 11 74083587 missense possibly damaging 0.86
R2124:Zfp616 UTSW 11 74083043 unclassified probably null
R2126:Zfp616 UTSW 11 74085403 missense probably benign 0.08
R2199:Zfp616 UTSW 11 74084630 missense possibly damaging 0.58
R2265:Zfp616 UTSW 11 74085463 missense possibly damaging 0.89
R2404:Zfp616 UTSW 11 74084856 missense probably damaging 1.00
R2508:Zfp616 UTSW 11 74083295 missense probably benign 0.01
R2519:Zfp616 UTSW 11 74084268 nonsense probably null
R3103:Zfp616 UTSW 11 74071735 missense probably benign 0.01
R3611:Zfp616 UTSW 11 74083442 missense possibly damaging 0.53
R3703:Zfp616 UTSW 11 74083319 nonsense probably null
R3744:Zfp616 UTSW 11 74083987 missense probably benign 0.01
R4043:Zfp616 UTSW 11 74085282 missense possibly damaging 0.50
R4384:Zfp616 UTSW 11 74083179 missense possibly damaging 0.94
R4469:Zfp616 UTSW 11 74071124 missense probably damaging 0.98
R4560:Zfp616 UTSW 11 74083034 missense probably benign 0.00
R4821:Zfp616 UTSW 11 74084207 missense probably benign 0.41
R4844:Zfp616 UTSW 11 74084399 missense probably benign 0.10
R4948:Zfp616 UTSW 11 74084004 missense possibly damaging 0.72
R5007:Zfp616 UTSW 11 74083817 missense possibly damaging 0.96
R5198:Zfp616 UTSW 11 74083510 missense probably benign 0.33
R5344:Zfp616 UTSW 11 74084495 missense possibly damaging 0.92
R5918:Zfp616 UTSW 11 74083260 missense possibly damaging 0.70
R5933:Zfp616 UTSW 11 74083126 missense probably damaging 0.96
R6084:Zfp616 UTSW 11 74083846 nonsense probably null
R6421:Zfp616 UTSW 11 74083870 missense possibly damaging 0.53
R6494:Zfp616 UTSW 11 74085192 missense probably damaging 1.00
R6523:Zfp616 UTSW 11 74083142 missense possibly damaging 0.79
R6849:Zfp616 UTSW 11 74085450 missense possibly damaging 0.70
R6910:Zfp616 UTSW 11 74085002 missense probably damaging 1.00
R7146:Zfp616 UTSW 11 74085261 missense possibly damaging 0.61
R7213:Zfp616 UTSW 11 74085863 missense probably benign 0.05
R7302:Zfp616 UTSW 11 74085379 missense probably benign 0.08
R7391:Zfp616 UTSW 11 74085329 missense probably benign 0.08
R7654:Zfp616 UTSW 11 74083187 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TGGAAGGTAGTTGTGGAAACTC -3'
(R):5'- TTATTATACCCTGGGGCCTGG -3'

Sequencing Primer
(F):5'- AGTAACATGGGCTATATTAAAAACCC -3'
(R):5'- CGATTCAATTAAAGCATTCCTGTATG -3'
Posted On2015-06-20