Mutagenetix > Incidental Mutation

Incidental Mutation 'R4273:Zfp616'

322285

Institutional Source

Beutler Lab

Gene Symbol

Zfp616

Ensembl Gene

ENSMUSG00000069476

Gene Name

zinc finger protein 616

Synonyms

Gm12330

MMRRC Submission

041645-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4273 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

74069955-74087292 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 74083700 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 265 (M265K)

Ref Sequence

ENSEMBL: ENSMUSP00000136549 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074813] [ENSMUST00000108463] [ENSMUST00000116546] [ENSMUST00000178159]

AlphaFold

J3QN14

Predicted Effect

probably benign
Transcript: ENSMUST00000074813

SMART Domains

Protein: ENSMUSP00000074365
Gene: ENSMUSG00000069476

Domain	Start	End	E-Value	Type
KRAB	8	68	1.79e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108463
AA Change: M356K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000104103
Gene: ENSMUSG00000069476
AA Change: M356K

Domain	Start	End	E-Value	Type
KRAB	8	68	1.79e-34	SMART
low complexity region	249	258	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000116546

SMART Domains

Protein: ENSMUSP00000112245
Gene: ENSMUSG00000069476

Domain	Start	End	E-Value	Type
KRAB	8	68	1.79e-34	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137407

Predicted Effect

probably benign
Transcript: ENSMUST00000178159
AA Change: M265K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000136549
Gene: ENSMUSG00000069476
AA Change: M265K

Domain	Start	End	E-Value	Type
internal_repeat_1	125	447	7.61e-6	PROSPERO
ZnF_C2H2	452	474	3.11e-2	SMART
ZnF_C2H2	509	531	2.61e-4	SMART
ZnF_C2H2	537	559	1.47e-3	SMART
ZnF_C2H2	565	587	5.21e-4	SMART
ZnF_C2H2	593	615	1.22e-4	SMART
ZnF_C2H2	621	643	2.57e-3	SMART
ZnF_C2H2	649	671	9.22e-5	SMART
ZnF_C2H2	677	699	5.9e-3	SMART
ZnF_C2H2	705	727	4.94e-5	SMART
ZnF_C2H2	733	755	8.34e-3	SMART
ZnF_C2H2	761	783	1.6e-4	SMART
ZnF_C2H2	789	811	6.88e-4	SMART
ZnF_C2H2	817	839	1.6e-4	SMART
ZnF_C2H2	845	867	1.3e-4	SMART
ZnF_C2H2	873	895	7.37e-4	SMART
ZnF_C2H2	901	923	1.6e-4	SMART
ZnF_C2H2	929	951	1.3e-4	SMART
ZnF_C2H2	957	979	3.95e-4	SMART

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer2	T	A	4: 86,874,598		probably null	Het
Adgrf2	T	A	17: 42,710,122	T604S	probably damaging	Het
Akap8l	T	A	17: 32,321,931	K533*	probably null	Het
Appbp2	T	C	11: 85,234,676	Y45C	probably damaging	Het
Arap2	T	C	5: 62,670,979	I950V	possibly damaging	Het
Arhgap31	T	C	16: 38,602,335	E1123G	possibly damaging	Het
Atp2c1	G	T	9: 105,435,140	N493K	probably benign	Het
Bcr	T	C	10: 75,125,111	I458T	probably damaging	Het
Brd4	G	A	17: 32,214,782	T468I	probably benign	Het
Cdh23	T	A	10: 60,311,161	D2774V	possibly damaging	Het
Cfdp1	T	C	8: 111,768,785	Y267C	probably damaging	Het
Chd6	C	A	2: 160,961,291	A2156S	probably benign	Het
Dazap2	C	A	15: 100,618,090	P100T	probably damaging	Het
Disp1	T	A	1: 183,087,644	I1071F	possibly damaging	Het
Dlgap1	T	A	17: 70,766,043	S686T	probably benign	Het
Dst	C	T	1: 34,192,340	R3183C	possibly damaging	Het
Enpp4	T	C	17: 44,101,807	N279D	probably benign	Het
Exoc3l	T	C	8: 105,289,961	*740W	probably null	Het
Exoc5	A	T	14: 49,015,480	C625*	probably null	Het
Fam98b	A	T	2: 117,260,231	N137Y	possibly damaging	Het
Fat4	T	A	3: 38,891,627	D1556E	probably damaging	Het
Fcer2a	C	A	8: 3,682,848	V319L	possibly damaging	Het
Fer1l6	T	C	15: 58,627,522	V1247A	probably benign	Het
Fmo4	A	G	1: 162,805,179	V201A	probably damaging	Het
Fras1	G	A	5: 96,614,904	G755D	probably benign	Het
Gm13078	A	T	4: 143,726,846	K175*	probably null	Het
Grid2	T	C	6: 63,909,045	Y142H	probably damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Ibtk	T	C	9: 85,726,731	Q376R	probably damaging	Het
Impdh2	T	C	9: 108,564,956	M414T	probably damaging	Het
Itm2c	A	G	1: 85,907,029	T160A	probably damaging	Het
Kcna2	T	A	3: 107,105,193	D363E	probably benign	Het
Lama2	C	T	10: 27,347,054	C412Y	probably damaging	Het
Lims2	C	G	18: 31,956,337	T151S	probably benign	Het
Mier1	T	C	4: 103,162,431	S423P	possibly damaging	Het
Mrgpra3	A	T	7: 47,589,432	W249R	probably benign	Het
Mtor	A	G	4: 148,550,152	H2410R	probably benign	Het
Mvp	C	T	7: 126,989,703	A631T	probably benign	Het
Nepro	T	C	16: 44,735,829	V450A	possibly damaging	Het
Ngrn	T	C	7: 80,264,521	V140A	probably damaging	Het
Nobox	T	C	6: 43,306,008	E231G	probably benign	Het
Olfr129	A	T	17: 38,055,272	I98N	probably damaging	Het
P3h2	T	A	16: 26,105,221	I155F	probably benign	Het
Pcdha3	C	T	18: 36,948,091	R629C	probably damaging	Het
Riok3	AGAAGCGG	AG	18: 12,135,941		probably benign	Het
Rttn	T	C	18: 89,091,896	I1675T	probably benign	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Slc35f4	G	T	14: 49,304,301	T182N	possibly damaging	Het
Slc52a3	T	A	2: 152,005,740	I256N	possibly damaging	Het
Sox9	T	C	11: 112,785,154	S390P	possibly damaging	Het
Tango2	T	C	16: 18,302,790		probably benign	Het
Tas1r1	T	C	4: 152,032,157	E340G	possibly damaging	Het
Tek	G	A	4: 94,829,970	G524R	probably damaging	Het
Tmem260	A	T	14: 48,505,304	Y532F	probably benign	Het
Tsks	C	A	7: 44,957,929	L559I	probably damaging	Het
Unc79	C	A	12: 103,122,353	L1702I	probably damaging	Het
Vmn1r14	T	A	6: 57,234,148	I237N	probably damaging	Het
Vmn2r17	G	A	5: 109,452,966	C710Y	probably benign	Het
Zfp119b	G	T	17: 55,938,926	T420K	possibly damaging	Het
Zfp202	C	T	9: 40,207,494	R68*	probably null	Het
Zfp229	T	A	17: 21,746,821	S677R	probably benign	Het
Zfp462	C	T	4: 55,008,411	H126Y	probably benign	Het
Zfp52	C	A	17: 21,560,197	Y102*	probably null	Het
Zfyve9	A	T	4: 108,680,976	I1031N	probably damaging	Het
Zmynd11	T	C	13: 9,697,690	Y203C	probably damaging	Het

Other mutations in Zfp616

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Zfp616	APN	11	74083613	missense	probably damaging	0.98
IGL00570:Zfp616	APN	11	74085805	missense	probably benign	0.03
IGL00594:Zfp616	APN	11	74082963	missense	possibly damaging	0.72
IGL01861:Zfp616	APN	11	74082916	missense	possibly damaging	0.53
IGL03022:Zfp616	APN	11	74082974	missense	possibly damaging	0.85
R0197:Zfp616	UTSW	11	74085674	missense	probably damaging	1.00
R0442:Zfp616	UTSW	11	74084495	missense	possibly damaging	0.92
R0497:Zfp616	UTSW	11	74083480	missense	probably benign	0.00
R0651:Zfp616	UTSW	11	74083729	nonsense	probably null
R0730:Zfp616	UTSW	11	74084822	missense	probably damaging	1.00
R0883:Zfp616	UTSW	11	74085674	missense	probably damaging	1.00
R0926:Zfp616	UTSW	11	74085818	missense	probably benign	0.04
R0940:Zfp616	UTSW	11	74085024	missense	probably damaging	1.00
R1068:Zfp616	UTSW	11	74082941	makesense	probably null
R1272:Zfp616	UTSW	11	74085236	missense	probably benign	0.08
R1446:Zfp616	UTSW	11	74083238	splice site	probably null
R1482:Zfp616	UTSW	11	74083977	missense	possibly damaging	0.72
R1553:Zfp616	UTSW	11	74083918	missense	possibly damaging	0.53
R1564:Zfp616	UTSW	11	74084722	missense	probably damaging	1.00
R1728:Zfp616	UTSW	11	74085771	missense	probably damaging	0.99
R1796:Zfp616	UTSW	11	74085845	missense	probably damaging	0.98
R1797:Zfp616	UTSW	11	74085279	nonsense	probably null
R1993:Zfp616	UTSW	11	74084969	missense	probably benign	0.08
R2026:Zfp616	UTSW	11	74083587	missense	possibly damaging	0.86
R2124:Zfp616	UTSW	11	74083043	splice site	probably null
R2126:Zfp616	UTSW	11	74085403	missense	probably benign	0.08
R2199:Zfp616	UTSW	11	74084630	missense	possibly damaging	0.58
R2265:Zfp616	UTSW	11	74085463	missense	possibly damaging	0.89
R2404:Zfp616	UTSW	11	74084856	missense	probably damaging	1.00
R2508:Zfp616	UTSW	11	74083295	missense	probably benign	0.01
R2519:Zfp616	UTSW	11	74084268	nonsense	probably null
R3103:Zfp616	UTSW	11	74071735	missense	probably benign	0.01
R3611:Zfp616	UTSW	11	74083442	missense	possibly damaging	0.53
R3703:Zfp616	UTSW	11	74083319	nonsense	probably null
R3744:Zfp616	UTSW	11	74083987	missense	probably benign	0.01
R4043:Zfp616	UTSW	11	74085282	missense	possibly damaging	0.50
R4384:Zfp616	UTSW	11	74083179	missense	possibly damaging	0.94
R4469:Zfp616	UTSW	11	74071124	missense	probably damaging	0.98
R4560:Zfp616	UTSW	11	74083034	missense	probably benign	0.00
R4821:Zfp616	UTSW	11	74084207	missense	probably benign	0.41
R4844:Zfp616	UTSW	11	74084399	missense	probably benign	0.10
R4948:Zfp616	UTSW	11	74084004	missense	possibly damaging	0.72
R5007:Zfp616	UTSW	11	74083817	missense	possibly damaging	0.96
R5198:Zfp616	UTSW	11	74083510	missense	probably benign	0.33
R5344:Zfp616	UTSW	11	74084495	missense	possibly damaging	0.92
R5918:Zfp616	UTSW	11	74083260	missense	possibly damaging	0.70
R5933:Zfp616	UTSW	11	74083126	missense	probably damaging	0.96
R6084:Zfp616	UTSW	11	74083846	nonsense	probably null
R6421:Zfp616	UTSW	11	74083870	missense	possibly damaging	0.53
R6494:Zfp616	UTSW	11	74085192	missense	probably damaging	1.00
R6523:Zfp616	UTSW	11	74083142	missense	possibly damaging	0.79
R6849:Zfp616	UTSW	11	74085450	missense	possibly damaging	0.70
R6910:Zfp616	UTSW	11	74085002	missense	probably damaging	1.00
R7146:Zfp616	UTSW	11	74085261	missense	possibly damaging	0.61
R7213:Zfp616	UTSW	11	74085863	missense	probably benign	0.05
R7302:Zfp616	UTSW	11	74085379	missense	probably benign	0.08
R7391:Zfp616	UTSW	11	74085329	missense	probably benign	0.08
R7654:Zfp616	UTSW	11	74083187	missense	possibly damaging	0.53
R7877:Zfp616	UTSW	11	74084362	missense	probably damaging	1.00
R7889:Zfp616	UTSW	11	74085445	missense	probably damaging	1.00
R8022:Zfp616	UTSW	11	74084068	missense	probably benign
R8061:Zfp616	UTSW	11	74083514	missense	possibly damaging	0.96
R8212:Zfp616	UTSW	11	74085743	missense	probably damaging	0.96
R8335:Zfp616	UTSW	11	74083900	nonsense	probably null
R8361:Zfp616	UTSW	11	74084650	missense	probably damaging	0.98
R8486:Zfp616	UTSW	11	74084083	missense	probably benign	0.18
R8695:Zfp616	UTSW	11	74084884	missense	probably benign	0.45
R8808:Zfp616	UTSW	11	74085697	missense	probably damaging	1.00
R9022:Zfp616	UTSW	11	74085713	missense	probably damaging	1.00
R9126:Zfp616	UTSW	11	74085454	missense	probably damaging	1.00
R9164:Zfp616	UTSW	11	74084999	missense	probably damaging	1.00
R9293:Zfp616	UTSW	11	74083918	missense	possibly damaging	0.53
R9421:Zfp616	UTSW	11	74083505	missense	possibly damaging	0.72
R9512:Zfp616	UTSW	11	74085110	missense	probably damaging	1.00
R9529:Zfp616	UTSW	11	74084834	missense	probably damaging	1.00
R9529:Zfp616	UTSW	11	74085770	missense	possibly damaging	0.90
R9606:Zfp616	UTSW	11	74085394	missense	probably damaging	1.00
R9708:Zfp616	UTSW	11	74085457	missense	probably damaging	1.00
R9788:Zfp616	UTSW	11	74084450	missense	probably damaging	0.99
Z1176:Zfp616	UTSW	11	74083033	missense	probably benign
Z1176:Zfp616	UTSW	11	74083219	missense	possibly damaging	0.72
Z1176:Zfp616	UTSW	11	74085641	missense	possibly damaging	0.90
Z1177:Zfp616	UTSW	11	74085052	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- TGGAAGGTAGTTGTGGAAACTC -3'
(R):5'- TTATTATACCCTGGGGCCTGG -3'

Sequencing Primer
(F):5'- AGTAACATGGGCTATATTAAAAACCC -3'
(R):5'- CGATTCAATTAAAGCATTCCTGTATG -3'

Posted On

2015-06-20