Incidental Mutation 'R4273:Sox9'
ID322287
Institutional Source Beutler Lab
Gene Symbol Sox9
Ensembl Gene ENSMUSG00000000567
Gene NameSRY (sex determining region Y)-box 9
Synonyms2010306G03Rik
MMRRC Submission 041645-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4273 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location112782224-112787760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112785154 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 390 (S390P)
Ref Sequence ENSEMBL: ENSMUSP00000000579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000579]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000579
AA Change: S390P

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000000579
Gene: ENSMUSG00000000567
AA Change: S390P

DomainStartEndE-ValueType
Pfam:Sox_N 22 94 9.6e-29 PFAM
HMG 104 174 2.34e-27 SMART
low complexity region 186 196 N/A INTRINSIC
low complexity region 234 241 N/A INTRINSIC
low complexity region 339 377 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137081
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene recognizes the sequence CCTTGAG along with other members of the HMG-box class DNA-binding proteins. It acts during chondrocyte differentiation and, with steroidogenic factor 1, regulates transcription of the anti-Muellerian hormone (AMH) gene. Deficiencies lead to the skeletal malformation syndrome campomelic dysplasia, frequently with sex reversal. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null mutant heterozygotes and conditional knockout mutants display perinatal lethality with cleft palate, hypoplasia and distortion of numerous cartilage-derived skeletal structures, and premature mineralization in many bones. Specific conditional knockout mutations are sex-reversed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,598 probably null Het
Adgrf2 T A 17: 42,710,122 T604S probably damaging Het
Akap8l T A 17: 32,321,931 K533* probably null Het
Appbp2 T C 11: 85,234,676 Y45C probably damaging Het
Arap2 T C 5: 62,670,979 I950V possibly damaging Het
Arhgap31 T C 16: 38,602,335 E1123G possibly damaging Het
Atp2c1 G T 9: 105,435,140 N493K probably benign Het
Bcr T C 10: 75,125,111 I458T probably damaging Het
Brd4 G A 17: 32,214,782 T468I probably benign Het
Cdh23 T A 10: 60,311,161 D2774V possibly damaging Het
Cfdp1 T C 8: 111,768,785 Y267C probably damaging Het
Chd6 C A 2: 160,961,291 A2156S probably benign Het
Dazap2 C A 15: 100,618,090 P100T probably damaging Het
Disp1 T A 1: 183,087,644 I1071F possibly damaging Het
Dlgap1 T A 17: 70,766,043 S686T probably benign Het
Dst C T 1: 34,192,340 R3183C possibly damaging Het
Enpp4 T C 17: 44,101,807 N279D probably benign Het
Exoc3l T C 8: 105,289,961 *740W probably null Het
Exoc5 A T 14: 49,015,480 C625* probably null Het
Fam98b A T 2: 117,260,231 N137Y possibly damaging Het
Fat4 T A 3: 38,891,627 D1556E probably damaging Het
Fcer2a C A 8: 3,682,848 V319L possibly damaging Het
Fer1l6 T C 15: 58,627,522 V1247A probably benign Het
Fmo4 A G 1: 162,805,179 V201A probably damaging Het
Fras1 G A 5: 96,614,904 G755D probably benign Het
Gm13078 A T 4: 143,726,846 K175* probably null Het
Grid2 T C 6: 63,909,045 Y142H probably damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ibtk T C 9: 85,726,731 Q376R probably damaging Het
Impdh2 T C 9: 108,564,956 M414T probably damaging Het
Itm2c A G 1: 85,907,029 T160A probably damaging Het
Kcna2 T A 3: 107,105,193 D363E probably benign Het
Lama2 C T 10: 27,347,054 C412Y probably damaging Het
Lims2 C G 18: 31,956,337 T151S probably benign Het
Mier1 T C 4: 103,162,431 S423P possibly damaging Het
Mrgpra3 A T 7: 47,589,432 W249R probably benign Het
Mtor A G 4: 148,550,152 H2410R probably benign Het
Mvp C T 7: 126,989,703 A631T probably benign Het
Nepro T C 16: 44,735,829 V450A possibly damaging Het
Ngrn T C 7: 80,264,521 V140A probably damaging Het
Nobox T C 6: 43,306,008 E231G probably benign Het
Olfr129 A T 17: 38,055,272 I98N probably damaging Het
P3h2 T A 16: 26,105,221 I155F probably benign Het
Pcdha3 C T 18: 36,948,091 R629C probably damaging Het
Riok3 AGAAGCGG AG 18: 12,135,941 probably benign Het
Rttn T C 18: 89,091,896 I1675T probably benign Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Slc35f4 G T 14: 49,304,301 T182N possibly damaging Het
Slc52a3 T A 2: 152,005,740 I256N possibly damaging Het
Tango2 T C 16: 18,302,790 probably benign Het
Tas1r1 T C 4: 152,032,157 E340G possibly damaging Het
Tek G A 4: 94,829,970 G524R probably damaging Het
Tmem260 A T 14: 48,505,304 Y532F probably benign Het
Tsks C A 7: 44,957,929 L559I probably damaging Het
Unc79 C A 12: 103,122,353 L1702I probably damaging Het
Vmn1r14 T A 6: 57,234,148 I237N probably damaging Het
Vmn2r17 G A 5: 109,452,966 C710Y probably benign Het
Zfp119b G T 17: 55,938,926 T420K possibly damaging Het
Zfp202 C T 9: 40,207,494 R68* probably null Het
Zfp229 T A 17: 21,746,821 S677R probably benign Het
Zfp462 C T 4: 55,008,411 H126Y probably benign Het
Zfp52 C A 17: 21,560,197 Y102* probably null Het
Zfp616 T A 11: 74,083,700 M265K probably benign Het
Zfyve9 A T 4: 108,680,976 I1031N probably damaging Het
Zmynd11 T C 13: 9,697,690 Y203C probably damaging Het
Other mutations in Sox9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Sox9 APN 11 112784674 missense probably benign 0.00
IGL02257:Sox9 APN 11 112784985 missense possibly damaging 0.84
IGL02935:Sox9 APN 11 112785349 missense probably damaging 0.99
R0350:Sox9 UTSW 11 112784876 missense probably damaging 0.99
R0634:Sox9 UTSW 11 112784942 missense probably damaging 0.98
R4692:Sox9 UTSW 11 112782977 missense probably benign 0.01
R5328:Sox9 UTSW 11 112782658 missense probably benign 0.39
R5501:Sox9 UTSW 11 112783859 missense probably damaging 1.00
R5905:Sox9 UTSW 11 112783820 missense probably damaging 1.00
R6707:Sox9 UTSW 11 112782872 missense probably damaging 0.99
R6834:Sox9 UTSW 11 112784000 missense probably benign 0.01
R7897:Sox9 UTSW 11 112784809 missense probably benign 0.22
Z1176:Sox9 UTSW 11 112785122 missense possibly damaging 0.51
Z1177:Sox9 UTSW 11 112784803 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- ACTGGCAGTTACGGCATCAG -3'
(R):5'- TAGGAGCCGGAGTTCTGATG -3'

Sequencing Primer
(F):5'- GTTACGGCATCAGCAGCAC -3'
(R):5'- CCGGAGTTCTGATGGTCAGC -3'
Posted On2015-06-20