Mutagenetix > Incidental Mutation

Incidental Mutation 'R0001:Ubr4'

32229

Institutional Source

Beutler Lab

Gene Symbol

Ubr4

Ensembl Gene

ENSMUSG00000066036

Gene Name

ubiquitin protein ligase E3 component n-recognin 4

Synonyms

LOC381562, D930005K06Rik, Zubr1, p600, 1810009A16Rik, A930005E13Rik

MMRRC Submission

038297-MU

Accession Numbers

Ncbi RefSeq: NM_001160319.1; MGI:1916366

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0001 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

139352609-139489588 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 139451788 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 3316 (L3316Q)

Ref Sequence

ENSEMBL: ENSMUSP00000095433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097822] [ENSMUST00000147999] [ENSMUST00000165860]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000097822
AA Change: L3316Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095433
Gene: ENSMUSG00000066036
AA Change: L3316Q

Domain	Start	End	E-Value	Type
low complexity region	5	20	N/A	INTRINSIC
low complexity region	414	425	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC
low complexity region	555	566	N/A	INTRINSIC
low complexity region	571	588	N/A	INTRINSIC
low complexity region	600	621	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
low complexity region	1642	1655	N/A	INTRINSIC
Pfam:zf-UBR	1660	1725	1.9e-9	PFAM
Blast:ZnF_C2H2	1966	1991	6e-8	BLAST
low complexity region	2268	2279	N/A	INTRINSIC
low complexity region	2502	2540	N/A	INTRINSIC
low complexity region	2725	2735	N/A	INTRINSIC
low complexity region	2818	2852	N/A	INTRINSIC
low complexity region	2887	2905	N/A	INTRINSIC
low complexity region	2928	2942	N/A	INTRINSIC
low complexity region	2945	2959	N/A	INTRINSIC
low complexity region	2966	2986	N/A	INTRINSIC
low complexity region	3063	3091	N/A	INTRINSIC
low complexity region	3329	3385	N/A	INTRINSIC
low complexity region	3776	3788	N/A	INTRINSIC
Pfam:E3_UbLigase_R4	4364	5160	N/A	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000129949
AA Change: L2003Q

SMART Domains

Protein: ENSMUSP00000115711
Gene: ENSMUSG00000066036
AA Change: L2003Q

Domain	Start	End	E-Value	Type
low complexity region	24	42	N/A	INTRINSIC
low complexity region	354	367	N/A	INTRINSIC
Pfam:zf-UBR	372	437	2.1e-10	PFAM
Blast:ZnF_C2H2	678	703	5e-8	BLAST
low complexity region	980	991	N/A	INTRINSIC
low complexity region	1225	1263	N/A	INTRINSIC
low complexity region	1448	1458	N/A	INTRINSIC
low complexity region	1575	1593	N/A	INTRINSIC
low complexity region	1616	1630	N/A	INTRINSIC
low complexity region	1633	1647	N/A	INTRINSIC
low complexity region	1654	1674	N/A	INTRINSIC
low complexity region	1751	1779	N/A	INTRINSIC
low complexity region	2017	2045	N/A	INTRINSIC
low complexity region	2048	2065	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000147999
AA Change: L157Q

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036
AA Change: L157Q

Domain	Start	End	E-Value	Type
low complexity region	170	226	N/A	INTRINSIC
low complexity region	617	629	N/A	INTRINSIC
Pfam:E3_UbLigase_R4	1205	1301	4.5e-60	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000165860
AA Change: L3292Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125800
Gene: ENSMUSG00000066036
AA Change: L3292Q

Domain	Start	End	E-Value	Type
low complexity region	5	20	N/A	INTRINSIC
low complexity region	414	425	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC
low complexity region	555	566	N/A	INTRINSIC
low complexity region	571	588	N/A	INTRINSIC
low complexity region	600	621	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
low complexity region	1642	1655	N/A	INTRINSIC
Pfam:zf-UBR	1659	1729	4e-13	PFAM
Blast:ZnF_C2H2	1966	1991	5e-8	BLAST
low complexity region	2268	2279	N/A	INTRINSIC
low complexity region	2513	2551	N/A	INTRINSIC
low complexity region	2736	2746	N/A	INTRINSIC
low complexity region	2863	2881	N/A	INTRINSIC
low complexity region	2904	2918	N/A	INTRINSIC
low complexity region	2921	2935	N/A	INTRINSIC
low complexity region	2942	2962	N/A	INTRINSIC
low complexity region	3039	3067	N/A	INTRINSIC
low complexity region	3305	3361	N/A	INTRINSIC
low complexity region	3752	3764	N/A	INTRINSIC
Pfam:E3_UbLigase_R4	4340	5136	N/A	PFAM

Meta Mutation Damage Score

0.6934

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.6%

Validation Efficiency

99% (76/77)

MGI Phenotype

Strain: 5286698
Lethality: D1-D5
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase that interacts with the retinoblastoma-associated protein in the nucleus and with calcium-bound calmodulin in the cytoplasm. The encoded protein appears to be a cytoskeletal component in the cytoplasm and part of the chromatin scaffold in the nucleus. In addition, this protein is a target of the human papillomavirus type 16 E7 oncoprotein. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit neonatal lethality and decreased body size at birth. Mice homozygous for a null mutation display complete embryonic lethality during organogenesis with arrest of vitelline vascular remodeling. [provided by MGI curators]

Allele List at MGI

All alleles(59) : Targeted(2) Gene trapped(56) Transgenic(1)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019N19Rik	G	A	19: 58,789,171	A61V	probably damaging	Het
2900092C05Rik	T	A	7: 12,554,607		probably benign	Het
A4galt	A	G	15: 83,228,289	F98L	probably benign	Het
Abca4	T	G	3: 122,081,011		probably benign	Het
Acacb	C	T	5: 114,204,833		probably benign	Het
Agbl1	A	T	7: 76,419,863	H367L	probably damaging	Het
Apoa4	C	A	9: 46,242,892	Q264K	probably benign	Het
Camsap2	A	T	1: 136,282,888		probably benign	Het
Cdan1	C	A	2: 120,723,751	R939L	probably benign	Het
Ceacam18	G	A	7: 43,636,876	V58I	possibly damaging	Het
Ciita	A	T	16: 10,514,433		probably benign	Het
Clk4	T	A	11: 51,268,765		probably benign	Het
Cntnap2	T	C	6: 46,530,171	D215G	probably benign	Het
Col11a2	T	C	17: 34,061,612	S1218P	probably benign	Het
Col20a1	T	C	2: 180,984,412		probably benign	Het
Ctsb	A	G	14: 63,135,622	E76G	probably benign	Het
Ctu2	T	C	8: 122,478,920	C161R	probably benign	Het
Dhx29	T	C	13: 112,964,556	L1211P	probably damaging	Het
Dhx9	G	T	1: 153,462,636	T759K	probably damaging	Het
Dmxl1	T	C	18: 49,888,897		probably benign	Het
Dpysl3	C	T	18: 43,358,375	E226K	possibly damaging	Het
Eif2d	A	T	1: 131,168,127	K453*	probably null	Het
Epha7	T	C	4: 28,961,279		probably benign	Het
Fam160b1	T	A	19: 57,381,756	H477Q	probably benign	Het
Fat3	T	C	9: 16,377,873	D118G	probably damaging	Het
Foxn4	T	A	5: 114,260,870	Q159L	probably damaging	Het
Frs2	G	T	10: 117,074,876	H194N	possibly damaging	Het
Fut8	A	T	12: 77,475,315	*576L	probably null	Het
Galns	T	C	8: 122,595,883		probably benign	Het
Gamt	G	A	10: 80,259,061		probably benign	Het
Gpn1	T	A	5: 31,495,617		probably benign	Het
Ipcef1	G	T	10: 6,900,600	H330Q	probably damaging	Het
Itga4	A	C	2: 79,326,587	Y1024S	probably damaging	Het
Jak2	A	G	19: 29,282,387	I229V	probably benign	Het
Katnal1	A	G	5: 148,921,275	S42P	probably damaging	Het
Kcnu1	A	T	8: 25,859,270	D142V	probably damaging	Het
Lig3	C	T	11: 82,790,591	R470W	probably damaging	Het
Mgat4c	A	G	10: 102,388,956	S344G	probably benign	Het
Miox	C	T	15: 89,336,274	L189F	possibly damaging	Het
Mipol1	C	T	12: 57,460,839		probably benign	Het
Mki67	C	T	7: 135,699,172	V1378M	probably damaging	Het
Mki67	T	A	7: 135,701,019	D762V	probably damaging	Het
Mmp9	A	G	2: 164,948,383	T43A	probably benign	Het
Muc6	T	C	7: 141,641,574	T1316A	possibly damaging	Het
Naip5	A	G	13: 100,214,650		probably null	Het
Naip5	C	A	13: 100,223,114	S538I	probably benign	Het
Nek3	A	T	8: 22,158,612		probably benign	Het
Nlrp1b	A	G	11: 71,161,759	S948P	probably damaging	Het
Nyap2	A	T	1: 81,192,107	H193L	probably benign	Het
Olfr1413	A	G	1: 92,573,461	K97E	possibly damaging	Het
Olfr648	T	A	7: 104,179,473	K312*	probably null	Het
Patl2	G	A	2: 122,125,710		probably benign	Het
Pcdhb11	A	T	18: 37,423,989	R791W	probably benign	Het
Pkd1l3	C	A	8: 109,628,633		probably benign	Het
Pkn2	A	T	3: 142,828,988	V73D	probably benign	Het
Pknox1	A	T	17: 31,599,636	H281L	probably damaging	Het
Polr3a	A	G	14: 24,452,189		probably benign	Het
Prss38	A	G	11: 59,373,180		probably benign	Het
Rad54l2	A	G	9: 106,708,217	F783S	probably damaging	Het
Rbm5	T	C	9: 107,742,424	R125G	probably damaging	Het
Rnpep	A	G	1: 135,272,485		probably benign	Het
Slc1a5	T	A	7: 16,793,637		probably null	Het
Slc22a4	G	A	11: 54,028,003		probably benign	Het
Spink12	T	C	18: 44,107,696	C50R	probably damaging	Het
Svep1	G	A	4: 58,066,460	T3208I	possibly damaging	Het
Tgm5	G	T	2: 121,077,646	D16E	probably damaging	Het
Tpp2	A	G	1: 43,971,726	N558D	probably benign	Het
Trappc9	A	T	15: 72,963,662	L507Q	probably damaging	Het
Trpm3	A	T	19: 22,715,331	Q262L	possibly damaging	Het
Ttn	A	G	2: 76,776,972		probably benign	Het
Ttn	G	A	2: 76,832,089		probably benign	Het
Uckl1	T	A	2: 181,574,655	Y136F	probably damaging	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Vps39	A	G	2: 120,318,053	V870A	probably benign	Het
Zdhhc25	A	G	15: 88,600,909	D149G	probably benign	Het
Zfp648	C	T	1: 154,205,286	T397M	probably damaging	Het
Zic2	C	A	14: 122,478,957	T435K	probably damaging	Het

Other mutations in Ubr4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Ubr4	APN	4	139465322	missense	possibly damaging	0.46
IGL00336:Ubr4	APN	4	139428566	missense	probably damaging	1.00
IGL00586:Ubr4	APN	4	139455184	missense	possibly damaging	0.95
IGL00659:Ubr4	APN	4	139421245	missense	probably damaging	1.00
IGL00766:Ubr4	APN	4	139440766	missense	probably damaging	1.00
IGL00819:Ubr4	APN	4	139476282	missense	possibly damaging	0.92
IGL00833:Ubr4	APN	4	139393159	critical splice donor site	probably null
IGL01126:Ubr4	APN	4	139402555	missense	probably benign	0.04
IGL01311:Ubr4	APN	4	139479045	missense	possibly damaging	0.66
IGL01349:Ubr4	APN	4	139480728	missense	unknown
IGL01388:Ubr4	APN	4	139460243	missense	possibly damaging	0.76
IGL01417:Ubr4	APN	4	139410800	missense	probably damaging	0.99
IGL01446:Ubr4	APN	4	139438040	splice site	probably benign
IGL01449:Ubr4	APN	4	139412736	missense	probably damaging	0.98
IGL01545:Ubr4	APN	4	139442829	splice site	probably benign
IGL01568:Ubr4	APN	4	139421373	missense	probably damaging	1.00
IGL01596:Ubr4	APN	4	139462534	splice site	probably benign
IGL01621:Ubr4	APN	4	139440783	nonsense	probably null
IGL01639:Ubr4	APN	4	139417344	missense	probably damaging	0.99
IGL01655:Ubr4	APN	4	139407796	missense	probably damaging	1.00
IGL01710:Ubr4	APN	4	139418461	missense	possibly damaging	0.81
IGL01830:Ubr4	APN	4	139472500	missense	probably damaging	0.99
IGL01862:Ubr4	APN	4	139477158	missense	possibly damaging	0.66
IGL01868:Ubr4	APN	4	139412678	nonsense	probably null
IGL01874:Ubr4	APN	4	139393289	splice site	probably benign
IGL01889:Ubr4	APN	4	139462472	nonsense	probably null
IGL01891:Ubr4	APN	4	139436260	critical splice donor site	probably null
IGL01980:Ubr4	APN	4	139429602	missense	probably damaging	0.99
IGL02126:Ubr4	APN	4	139452741	critical splice donor site	probably null
IGL02153:Ubr4	APN	4	139460160	nonsense	probably null
IGL02173:Ubr4	APN	4	139437070	splice site	probably null
IGL02214:Ubr4	APN	4	139428583	missense	possibly damaging	0.95
IGL02214:Ubr4	APN	4	139461827	critical splice acceptor site	probably null
IGL02220:Ubr4	APN	4	139388435	missense	probably benign	0.01
IGL02246:Ubr4	APN	4	139459103	missense	possibly damaging	0.89
IGL02264:Ubr4	APN	4	139455628	nonsense	probably null
IGL02273:Ubr4	APN	4	139472578	missense	possibly damaging	0.94
IGL02316:Ubr4	APN	4	139473178	missense	possibly damaging	0.46
IGL02328:Ubr4	APN	4	139478922	missense	probably damaging	0.97
IGL02476:Ubr4	APN	4	139421249	nonsense	probably null
IGL02477:Ubr4	APN	4	139436205	missense	probably damaging	0.98
IGL02544:Ubr4	APN	4	139415118	missense	probably damaging	1.00
IGL02622:Ubr4	APN	4	139467250	nonsense	probably null
IGL02679:Ubr4	APN	4	139459134	missense	probably damaging	0.99
IGL02728:Ubr4	APN	4	139468811	missense	probably damaging	1.00
IGL02754:Ubr4	APN	4	139410784	missense	probably damaging	0.99
IGL02754:Ubr4	APN	4	139393159	critical splice donor site	probably null
IGL02892:Ubr4	APN	4	139417331	missense	probably damaging	0.96
IGL02897:Ubr4	APN	4	139472508	missense	probably damaging	0.97
IGL02946:Ubr4	APN	4	139425295	missense	probably damaging	1.00
IGL02964:Ubr4	APN	4	139407820	missense	possibly damaging	0.84
IGL03059:Ubr4	APN	4	139480676	missense	probably damaging	0.98
IGL03068:Ubr4	APN	4	139409730	missense	probably benign	0.02
IGL03087:Ubr4	APN	4	139450357	nonsense	probably null
IGL03116:Ubr4	APN	4	139479581	splice site	probably benign
IGL03212:Ubr4	APN	4	139409763	missense	probably benign	0.13
IGL03228:Ubr4	APN	4	139429598	missense	probably damaging	1.00
IGL03292:Ubr4	APN	4	139440435	missense	probably damaging	1.00
IGL03388:Ubr4	APN	4	139415032	missense	probably damaging	0.98
IGL03393:Ubr4	APN	4	139452678	missense	probably damaging	1.00
IGL03409:Ubr4	APN	4	139399929	nonsense	probably null
Aqua_regia	UTSW	4	139452719	nonsense	probably null
Eats	UTSW	4	139463575	missense	probably damaging	0.97
Hardened	UTSW	4	139468847	missense	probably damaging	1.00
Stoney	UTSW	4	139444687	missense	probably damaging	1.00
Uber	UTSW	4	139479062	critical splice donor site	probably null
BB001:Ubr4	UTSW	4	139467276	missense	unknown
BB011:Ubr4	UTSW	4	139467276	missense	unknown
P0019:Ubr4	UTSW	4	139451781	missense	probably damaging	1.00
PIT4544001:Ubr4	UTSW	4	139402560	missense	possibly damaging	0.93
R0002:Ubr4	UTSW	4	139390900	missense	probably damaging	1.00
R0006:Ubr4	UTSW	4	139431649	missense	probably benign	0.03
R0006:Ubr4	UTSW	4	139431649	missense	probably benign	0.03
R0008:Ubr4	UTSW	4	139430176	missense	probably damaging	1.00
R0027:Ubr4	UTSW	4	139400393	missense	probably damaging	0.99
R0027:Ubr4	UTSW	4	139400393	missense	probably damaging	0.99
R0030:Ubr4	UTSW	4	139426793	missense	probably damaging	1.00
R0044:Ubr4	UTSW	4	139437058	splice site	probably benign
R0044:Ubr4	UTSW	4	139437058	splice site	probably benign
R0088:Ubr4	UTSW	4	139440814	missense	probably damaging	1.00
R0131:Ubr4	UTSW	4	139464051	missense	possibly damaging	0.66
R0184:Ubr4	UTSW	4	139445262	missense	probably damaging	1.00
R0219:Ubr4	UTSW	4	139430257	missense	possibly damaging	0.64
R0227:Ubr4	UTSW	4	139431649	missense	probably benign	0.03
R0270:Ubr4	UTSW	4	139479435	splice site	probably benign
R0285:Ubr4	UTSW	4	139440801	missense	probably damaging	1.00
R0322:Ubr4	UTSW	4	139422418	missense	probably damaging	1.00
R0363:Ubr4	UTSW	4	139391860	missense	probably damaging	0.98
R0393:Ubr4	UTSW	4	139410860	splice site	probably benign
R0450:Ubr4	UTSW	4	139430223	missense	probably benign	0.14
R0504:Ubr4	UTSW	4	139406578	missense	probably damaging	1.00
R0504:Ubr4	UTSW	4	139480838	critical splice donor site	probably null
R0510:Ubr4	UTSW	4	139430223	missense	probably benign	0.14
R0513:Ubr4	UTSW	4	139416875	missense	possibly damaging	0.74
R0517:Ubr4	UTSW	4	139392124	missense	probably benign	0.00
R0558:Ubr4	UTSW	4	139426902	missense	probably benign	0.09
R0617:Ubr4	UTSW	4	139479062	critical splice donor site	probably null
R0636:Ubr4	UTSW	4	139436302	splice site	probably null
R0637:Ubr4	UTSW	4	139399615	missense	probably damaging	1.00
R0652:Ubr4	UTSW	4	139401326	missense	probably damaging	0.99
R0691:Ubr4	UTSW	4	139423906	missense	probably damaging	1.00
R0729:Ubr4	UTSW	4	139485320	missense	possibly damaging	0.66
R0735:Ubr4	UTSW	4	139428028	splice site	probably null
R0751:Ubr4	UTSW	4	139437198	splice site	probably benign
R0789:Ubr4	UTSW	4	139410271	critical splice donor site	probably null
R0825:Ubr4	UTSW	4	139479576	critical splice donor site	probably null
R0828:Ubr4	UTSW	4	139450553	splice site	probably benign
R1052:Ubr4	UTSW	4	139455460	missense	possibly damaging	0.83
R1184:Ubr4	UTSW	4	139437198	splice site	probably benign
R1222:Ubr4	UTSW	4	139388471	splice site	probably null
R1258:Ubr4	UTSW	4	139426914	missense	probably damaging	1.00
R1321:Ubr4	UTSW	4	139460123	missense	possibly damaging	0.46
R1385:Ubr4	UTSW	4	139402612	missense	probably benign	0.00
R1450:Ubr4	UTSW	4	139468028	missense	probably damaging	1.00
R1470:Ubr4	UTSW	4	139421226	splice site	probably null
R1470:Ubr4	UTSW	4	139421226	splice site	probably null
R1474:Ubr4	UTSW	4	139429579	missense	probably damaging	1.00
R1479:Ubr4	UTSW	4	139425840	missense	possibly damaging	0.95
R1534:Ubr4	UTSW	4	139428151	missense	possibly damaging	0.95
R1546:Ubr4	UTSW	4	139416927	nonsense	probably null
R1785:Ubr4	UTSW	4	139423945	missense	probably damaging	1.00
R1786:Ubr4	UTSW	4	139423945	missense	probably damaging	1.00
R1789:Ubr4	UTSW	4	139393053	missense	probably damaging	1.00
R1796:Ubr4	UTSW	4	139428596	missense	probably benign	0.25
R1800:Ubr4	UTSW	4	139407963	missense	probably damaging	0.99
R1801:Ubr4	UTSW	4	139452563	splice site	probably null
R1827:Ubr4	UTSW	4	139425697	critical splice acceptor site	probably null
R1887:Ubr4	UTSW	4	139455560	missense	probably damaging	1.00
R1966:Ubr4	UTSW	4	139451244	critical splice acceptor site	probably null
R2010:Ubr4	UTSW	4	139480652	missense	possibly damaging	0.92
R2049:Ubr4	UTSW	4	139477207	missense	probably damaging	0.97
R2069:Ubr4	UTSW	4	139479540	missense	possibly damaging	0.66
R2114:Ubr4	UTSW	4	139429611	nonsense	probably null
R2140:Ubr4	UTSW	4	139477207	missense	probably damaging	0.97
R2141:Ubr4	UTSW	4	139477207	missense	probably damaging	0.97
R2142:Ubr4	UTSW	4	139477207	missense	probably damaging	0.97
R2168:Ubr4	UTSW	4	139410649	missense	probably benign	0.25
R2237:Ubr4	UTSW	4	139442790	missense	probably damaging	1.00
R2249:Ubr4	UTSW	4	139448921	missense	probably damaging	1.00
R2261:Ubr4	UTSW	4	139413462	missense	probably damaging	0.99
R2264:Ubr4	UTSW	4	139420373	splice site	probably benign
R2353:Ubr4	UTSW	4	139433673	missense	possibly damaging	0.48
R2437:Ubr4	UTSW	4	139473542	missense	possibly damaging	0.90
R2496:Ubr4	UTSW	4	139473205	unclassified	probably benign
R2896:Ubr4	UTSW	4	139455644	splice site	probably null
R2922:Ubr4	UTSW	4	139479500	missense	possibly damaging	0.66
R2972:Ubr4	UTSW	4	139406536	missense	probably benign	0.22
R2973:Ubr4	UTSW	4	139406536	missense	probably benign	0.22
R2989:Ubr4	UTSW	4	139463558	missense	possibly damaging	0.89
R3176:Ubr4	UTSW	4	139421855	missense	probably benign	0.03
R3276:Ubr4	UTSW	4	139421855	missense	probably benign	0.03
R3772:Ubr4	UTSW	4	139452700	missense	possibly damaging	0.89
R3844:Ubr4	UTSW	4	139459126	missense	probably damaging	0.99
R3873:Ubr4	UTSW	4	139423990	missense	probably damaging	1.00
R3900:Ubr4	UTSW	4	139479062	critical splice donor site	probably null
R3951:Ubr4	UTSW	4	139393094	missense	probably damaging	1.00
R4020:Ubr4	UTSW	4	139451805	missense	probably damaging	0.98
R4178:Ubr4	UTSW	4	139393414	missense	probably damaging	1.00
R4308:Ubr4	UTSW	4	139472509	missense	possibly damaging	0.46
R4378:Ubr4	UTSW	4	139410440	missense	possibly damaging	0.76
R4400:Ubr4	UTSW	4	139461856	missense	possibly damaging	0.66
R4421:Ubr4	UTSW	4	139461856	missense	possibly damaging	0.66
R4462:Ubr4	UTSW	4	139418502	missense	possibly damaging	0.47
R4583:Ubr4	UTSW	4	139380853	missense	possibly damaging	0.82
R4611:Ubr4	UTSW	4	139399579	missense	possibly damaging	0.93
R4664:Ubr4	UTSW	4	139406518	missense	possibly damaging	0.56
R4671:Ubr4	UTSW	4	139436191	missense	possibly damaging	0.66
R4672:Ubr4	UTSW	4	139410716	missense	probably damaging	0.99
R4673:Ubr4	UTSW	4	139410716	missense	probably damaging	0.99
R4696:Ubr4	UTSW	4	139408672	missense	probably benign	0.09
R4701:Ubr4	UTSW	4	139471336	missense	possibly damaging	0.66
R4705:Ubr4	UTSW	4	139450529	missense	probably damaging	1.00
R4726:Ubr4	UTSW	4	139482579	missense	possibly damaging	0.46
R4728:Ubr4	UTSW	4	139423879	missense	probably damaging	1.00
R4783:Ubr4	UTSW	4	139421733	missense	possibly damaging	0.85
R4833:Ubr4	UTSW	4	139402546	missense	probably damaging	0.98
R4892:Ubr4	UTSW	4	139428517	missense	probably benign	0.14
R4936:Ubr4	UTSW	4	139396566	missense	probably damaging	0.98
R5000:Ubr4	UTSW	4	139436169	missense	probably damaging	0.98
R5114:Ubr4	UTSW	4	139410623	missense	probably damaging	0.99
R5189:Ubr4	UTSW	4	139410649	missense	probably benign	0.25
R5197:Ubr4	UTSW	4	139468097	missense	probably damaging	1.00
R5213:Ubr4	UTSW	4	139402566	nonsense	probably null
R5219:Ubr4	UTSW	4	139477232	nonsense	probably null
R5346:Ubr4	UTSW	4	139428491	missense	probably damaging	0.97
R5368:Ubr4	UTSW	4	139397528	intron	probably benign
R5442:Ubr4	UTSW	4	139407772	missense	probably damaging	1.00
R5527:Ubr4	UTSW	4	139480788	missense	possibly damaging	0.83
R5548:Ubr4	UTSW	4	139460090	missense	probably damaging	0.97
R5568:Ubr4	UTSW	4	139392038	missense	probably damaging	0.99
R5639:Ubr4	UTSW	4	139452648	missense	possibly damaging	0.66
R5643:Ubr4	UTSW	4	139444687	missense	probably damaging	1.00
R5663:Ubr4	UTSW	4	139428583	missense	possibly damaging	0.95
R5755:Ubr4	UTSW	4	139460095	missense	possibly damaging	0.66
R5781:Ubr4	UTSW	4	139468096	missense	probably damaging	1.00
R5784:Ubr4	UTSW	4	139425218	missense	probably damaging	1.00
R5817:Ubr4	UTSW	4	139468847	missense	probably damaging	1.00
R5872:Ubr4	UTSW	4	139425330	missense	probably damaging	0.98
R5891:Ubr4	UTSW	4	139408626	nonsense	probably null
R5901:Ubr4	UTSW	4	139451254	missense	probably damaging	1.00
R5958:Ubr4	UTSW	4	139455638	missense	probably damaging	1.00
R5974:Ubr4	UTSW	4	139421078	splice site	probably null
R6065:Ubr4	UTSW	4	139421238	missense	probably damaging	1.00
R6109:Ubr4	UTSW	4	139417364	missense	probably damaging	0.99
R6207:Ubr4	UTSW	4	139421248	missense	probably damaging	1.00
R6265:Ubr4	UTSW	4	139452640	missense	possibly damaging	0.90
R6319:Ubr4	UTSW	4	139408889	missense	possibly damaging	0.84
R6342:Ubr4	UTSW	4	139429539	missense	possibly damaging	0.88
R6434:Ubr4	UTSW	4	139429638	missense	probably damaging	1.00
R6437:Ubr4	UTSW	4	139397214	critical splice donor site	probably null
R6481:Ubr4	UTSW	4	139431751	missense	probably damaging	0.97
R6502:Ubr4	UTSW	4	139444671	missense	probably damaging	1.00
R6546:Ubr4	UTSW	4	139414394	missense	probably damaging	0.99
R6603:Ubr4	UTSW	4	139455586	missense	probably benign	0.17
R6648:Ubr4	UTSW	4	139452719	nonsense	probably null
R6649:Ubr4	UTSW	4	139473624	missense	possibly damaging	0.66
R6653:Ubr4	UTSW	4	139473624	missense	possibly damaging	0.66
R6668:Ubr4	UTSW	4	139465341	missense	probably damaging	1.00
R6770:Ubr4	UTSW	4	139489182	missense	unknown
R6772:Ubr4	UTSW	4	139467230	nonsense	probably null
R6857:Ubr4	UTSW	4	139486051	missense	possibly damaging	0.90
R6869:Ubr4	UTSW	4	139467227	missense	possibly damaging	0.93
R6912:Ubr4	UTSW	4	139458234	critical splice donor site	probably null
R6943:Ubr4	UTSW	4	139437131	nonsense	probably null
R6970:Ubr4	UTSW	4	139406528	nonsense	probably null
R6976:Ubr4	UTSW	4	139393077	missense	probably damaging	0.98
R7000:Ubr4	UTSW	4	139414404	missense	probably damaging	1.00
R7017:Ubr4	UTSW	4	139393090	missense	probably damaging	0.99
R7165:Ubr4	UTSW	4	139450513	missense
R7222:Ubr4	UTSW	4	139463373	missense	unknown
R7241:Ubr4	UTSW	4	139443414	missense	probably damaging	1.00
R7343:Ubr4	UTSW	4	139413438	missense	probably benign	0.09
R7367:Ubr4	UTSW	4	139452691	missense	unknown
R7393:Ubr4	UTSW	4	139426785	missense	probably damaging	1.00
R7432:Ubr4	UTSW	4	139388382	missense	probably damaging	1.00
R7448:Ubr4	UTSW	4	139462467	missense	unknown
R7502:Ubr4	UTSW	4	139412672	missense	possibly damaging	0.72
R7514:Ubr4	UTSW	4	139452655	missense	unknown
R7526:Ubr4	UTSW	4	139422417	missense	probably benign	0.00
R7529:Ubr4	UTSW	4	139422417	missense	probably benign	0.00
R7666:Ubr4	UTSW	4	139413480	missense	possibly damaging	0.81
R7699:Ubr4	UTSW	4	139408867	nonsense	probably null
R7700:Ubr4	UTSW	4	139408867	nonsense	probably null
R7726:Ubr4	UTSW	4	139458920	missense	unknown
R7753:Ubr4	UTSW	4	139470292	missense	unknown
R7810:Ubr4	UTSW	4	139415083	missense
R7837:Ubr4	UTSW	4	139393151	nonsense	probably null
R7868:Ubr4	UTSW	4	139460033	missense	unknown
R7872:Ubr4	UTSW	4	139393062	missense	possibly damaging	0.94
R7887:Ubr4	UTSW	4	139407810	missense	probably damaging	0.99
R7924:Ubr4	UTSW	4	139467276	missense	unknown
R7980:Ubr4	UTSW	4	139418406	missense
R7982:Ubr4	UTSW	4	139428208	critical splice donor site	probably null
R8005:Ubr4	UTSW	4	139412630	missense	probably damaging	0.98
R8054:Ubr4	UTSW	4	139468102	missense	unknown
R8094:Ubr4	UTSW	4	139440696	missense	probably damaging	0.97
R8151:Ubr4	UTSW	4	139402801	missense	probably damaging	0.97
R8183:Ubr4	UTSW	4	139482471	missense	unknown
R8252:Ubr4	UTSW	4	139473217	missense	unknown
R8505:Ubr4	UTSW	4	139429569	missense
R8519:Ubr4	UTSW	4	139416647	missense	probably damaging	0.97
R8716:Ubr4	UTSW	4	139468853	missense	unknown
R8720:Ubr4	UTSW	4	139480838	critical splice donor site	probably null
R8749:Ubr4	UTSW	4	139402624	missense	probably damaging	0.98
R8768:Ubr4	UTSW	4	139421765	missense
R8789:Ubr4	UTSW	4	139410183	missense	possibly damaging	0.76
R8879:Ubr4	UTSW	4	139410518	missense	probably benign	0.06
R8937:Ubr4	UTSW	4	139463575	missense	probably damaging	0.97
R9006:Ubr4	UTSW	4	139444692	critical splice donor site	probably null
R9116:Ubr4	UTSW	4	139418474	missense
R9134:Ubr4	UTSW	4	139400444	critical splice donor site	probably null
R9251:Ubr4	UTSW	4	139450325	missense
R9340:Ubr4	UTSW	4	139455452	missense	unknown
R9384:Ubr4	UTSW	4	139467320	missense	unknown
R9389:Ubr4	UTSW	4	139425924	missense
R9393:Ubr4	UTSW	4	139485302	missense	unknown
R9531:Ubr4	UTSW	4	139407906	missense	probably benign	0.00
R9573:Ubr4	UTSW	4	139421139	missense
R9604:Ubr4	UTSW	4	139432516	critical splice donor site	probably null
R9613:Ubr4	UTSW	4	139421762	missense
R9623:Ubr4	UTSW	4	139431713	missense	probably benign	0.00
R9651:Ubr4	UTSW	4	139479548	missense	unknown
R9685:Ubr4	UTSW	4	139464030	missense	unknown
R9698:Ubr4	UTSW	4	139440664	missense
R9700:Ubr4	UTSW	4	139392077	missense	probably damaging	0.97
R9727:Ubr4	UTSW	4	139413424	missense	probably damaging	0.98
R9766:Ubr4	UTSW	4	139467284	missense	unknown
T0975:Ubr4	UTSW	4	139451781	missense	probably damaging	1.00
X0028:Ubr4	UTSW	4	139410271	critical splice donor site	probably null
Z1176:Ubr4	UTSW	4	139400385	missense	probably damaging	1.00
Z1176:Ubr4	UTSW	4	139402660	missense	probably benign	0.04
Z1176:Ubr4	UTSW	4	139410145	missense	probably damaging	1.00
Z1177:Ubr4	UTSW	4	139450481	missense
Z1186:Ubr4	UTSW	4	139410653	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AGAGCAGGACTTCCAGACTGTAGC -3'
(R):5'- AATGATATGACACACTCACGGGGC -3'

Sequencing Primer
(F):5'- TTCCAGACTGTAGCAGTAAAGTCAC -3'
(R):5'- CGCCTAGCACAGGATCTC -3'

Posted On

2013-05-09