Mutagenetix > Incidental Mutation

Incidental Mutation 'R4273:Sall2'

322293

Institutional Source

Beutler Lab

Gene Symbol

Sall2

Ensembl Gene

ENSMUSG00000049532

Gene Name

spalt like transcription factor 2

Synonyms

Msal-2

MMRRC Submission

041645-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4273 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

52311172-52328762 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 52313803 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 643 (R643L)

Ref Sequence

ENSEMBL: ENSMUSP00000154331 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]

AlphaFold

Q9QX96

Predicted Effect

probably damaging
Transcript: ENSMUST00000058326
AA Change: R645L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: R645L

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	97	110	N/A	INTRINSIC
low complexity region	128	139	N/A	INTRINSIC
low complexity region	151	170	N/A	INTRINSIC
ZnF_C2H2	372	394	2.57e-3	SMART
ZnF_C2H2	400	422	1.28e-3	SMART
low complexity region	476	501	N/A	INTRINSIC
low complexity region	602	627	N/A	INTRINSIC
ZnF_C2H2	629	651	1.2e1	SMART
ZnF_C2H2	657	679	1.69e-3	SMART
ZnF_C2H2	689	711	6.88e-4	SMART
low complexity region	719	730	N/A	INTRINSIC
low complexity region	747	779	N/A	INTRINSIC
low complexity region	799	819	N/A	INTRINSIC
low complexity region	829	848	N/A	INTRINSIC
ZnF_C2H2	908	930	2.09e-3	SMART
ZnF_C2H2	937	960	1.01e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000135523
AA Change: R643L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Meta Mutation Damage Score

0.2114

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer2	T	A	4: 86,874,598		probably null	Het
Adgrf2	T	A	17: 42,710,122	T604S	probably damaging	Het
Akap8l	T	A	17: 32,321,931	K533*	probably null	Het
Appbp2	T	C	11: 85,234,676	Y45C	probably damaging	Het
Arap2	T	C	5: 62,670,979	I950V	possibly damaging	Het
Arhgap31	T	C	16: 38,602,335	E1123G	possibly damaging	Het
Atp2c1	G	T	9: 105,435,140	N493K	probably benign	Het
Bcr	T	C	10: 75,125,111	I458T	probably damaging	Het
Brd4	G	A	17: 32,214,782	T468I	probably benign	Het
Cdh23	T	A	10: 60,311,161	D2774V	possibly damaging	Het
Cfdp1	T	C	8: 111,768,785	Y267C	probably damaging	Het
Chd6	C	A	2: 160,961,291	A2156S	probably benign	Het
Dazap2	C	A	15: 100,618,090	P100T	probably damaging	Het
Disp1	T	A	1: 183,087,644	I1071F	possibly damaging	Het
Dlgap1	T	A	17: 70,766,043	S686T	probably benign	Het
Dst	C	T	1: 34,192,340	R3183C	possibly damaging	Het
Enpp4	T	C	17: 44,101,807	N279D	probably benign	Het
Exoc3l	T	C	8: 105,289,961	*740W	probably null	Het
Exoc5	A	T	14: 49,015,480	C625*	probably null	Het
Fam98b	A	T	2: 117,260,231	N137Y	possibly damaging	Het
Fat4	T	A	3: 38,891,627	D1556E	probably damaging	Het
Fcer2a	C	A	8: 3,682,848	V319L	possibly damaging	Het
Fer1l6	T	C	15: 58,627,522	V1247A	probably benign	Het
Fmo4	A	G	1: 162,805,179	V201A	probably damaging	Het
Fras1	G	A	5: 96,614,904	G755D	probably benign	Het
Gm13078	A	T	4: 143,726,846	K175*	probably null	Het
Grid2	T	C	6: 63,909,045	Y142H	probably damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Ibtk	T	C	9: 85,726,731	Q376R	probably damaging	Het
Impdh2	T	C	9: 108,564,956	M414T	probably damaging	Het
Itm2c	A	G	1: 85,907,029	T160A	probably damaging	Het
Kcna2	T	A	3: 107,105,193	D363E	probably benign	Het
Lama2	C	T	10: 27,347,054	C412Y	probably damaging	Het
Lims2	C	G	18: 31,956,337	T151S	probably benign	Het
Mier1	T	C	4: 103,162,431	S423P	possibly damaging	Het
Mrgpra3	A	T	7: 47,589,432	W249R	probably benign	Het
Mtor	A	G	4: 148,550,152	H2410R	probably benign	Het
Mvp	C	T	7: 126,989,703	A631T	probably benign	Het
Nepro	T	C	16: 44,735,829	V450A	possibly damaging	Het
Ngrn	T	C	7: 80,264,521	V140A	probably damaging	Het
Nobox	T	C	6: 43,306,008	E231G	probably benign	Het
Olfr129	A	T	17: 38,055,272	I98N	probably damaging	Het
P3h2	T	A	16: 26,105,221	I155F	probably benign	Het
Pcdha3	C	T	18: 36,948,091	R629C	probably damaging	Het
Riok3	AGAAGCGG	AG	18: 12,135,941		probably benign	Het
Rttn	T	C	18: 89,091,896	I1675T	probably benign	Het
Slc35f4	G	T	14: 49,304,301	T182N	possibly damaging	Het
Slc52a3	T	A	2: 152,005,740	I256N	possibly damaging	Het
Sox9	T	C	11: 112,785,154	S390P	possibly damaging	Het
Tango2	T	C	16: 18,302,790		probably benign	Het
Tas1r1	T	C	4: 152,032,157	E340G	possibly damaging	Het
Tek	G	A	4: 94,829,970	G524R	probably damaging	Het
Tmem260	A	T	14: 48,505,304	Y532F	probably benign	Het
Tsks	C	A	7: 44,957,929	L559I	probably damaging	Het
Unc79	C	A	12: 103,122,353	L1702I	probably damaging	Het
Vmn1r14	T	A	6: 57,234,148	I237N	probably damaging	Het
Vmn2r17	G	A	5: 109,452,966	C710Y	probably benign	Het
Zfp119b	G	T	17: 55,938,926	T420K	possibly damaging	Het
Zfp202	C	T	9: 40,207,494	R68*	probably null	Het
Zfp229	T	A	17: 21,746,821	S677R	probably benign	Het
Zfp462	C	T	4: 55,008,411	H126Y	probably benign	Het
Zfp52	C	A	17: 21,560,197	Y102*	probably null	Het
Zfp616	T	A	11: 74,083,700	M265K	probably benign	Het
Zfyve9	A	T	4: 108,680,976	I1031N	probably damaging	Het
Zmynd11	T	C	13: 9,697,690	Y203C	probably damaging	Het

Other mutations in Sall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Sall2	APN	14	52314571	missense	probably damaging	1.00
IGL02152:Sall2	APN	14	52315514	missense	probably damaging	1.00
IGL02318:Sall2	APN	14	52315565	missense	probably damaging	1.00
IGL02933:Sall2	APN	14	52313027	missense	probably benign	0.00
IGL03165:Sall2	APN	14	52314168	missense	probably damaging	1.00
R1079:Sall2	UTSW	14	52313203	missense	probably benign	0.13
R1295:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1674:Sall2	UTSW	14	52313836	missense	probably damaging	1.00
R1840:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1989:Sall2	UTSW	14	52314439	missense	probably damaging	1.00
R2339:Sall2	UTSW	14	52313356	missense	probably damaging	1.00
R3407:Sall2	UTSW	14	52328104	missense	probably benign	0.03
R3870:Sall2	UTSW	14	52313994	missense	probably damaging	1.00
R3895:Sall2	UTSW	14	52314047	missense	probably damaging	0.99
R4059:Sall2	UTSW	14	52314571	missense	probably damaging	1.00
R4272:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4275:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4289:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4503:Sall2	UTSW	14	52313459	missense	probably benign
R4592:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4611:Sall2	UTSW	14	52313753	missense	probably damaging	1.00
R4615:Sall2	UTSW	14	52312750	missense	probably benign	0.20
R4640:Sall2	UTSW	14	52315159	missense	probably damaging	0.99
R4693:Sall2	UTSW	14	52314478	missense	probably damaging	1.00
R4921:Sall2	UTSW	14	52315393	missense	possibly damaging	0.93
R5007:Sall2	UTSW	14	52314493	missense	probably damaging	1.00
R5015:Sall2	UTSW	14	52315655	missense	possibly damaging	0.92
R5079:Sall2	UTSW	14	52314754	missense	probably damaging	1.00
R5419:Sall2	UTSW	14	52313129	missense	probably damaging	1.00
R5849:Sall2	UTSW	14	52314247	missense	probably benign	0.13
R6229:Sall2	UTSW	14	52313191	missense	probably benign
R6397:Sall2	UTSW	14	52315153	missense	probably damaging	1.00
R6422:Sall2	UTSW	14	52312724	makesense	probably null
R6456:Sall2	UTSW	14	52313593	missense	probably damaging	1.00
R6456:Sall2	UTSW	14	52313594	nonsense	probably null
R6786:Sall2	UTSW	14	52314621	missense	probably damaging	1.00
R7293:Sall2	UTSW	14	52314411	nonsense	probably null
R7496:Sall2	UTSW	14	52315561	missense	possibly damaging	0.63
R7792:Sall2	UTSW	14	52316064	missense	probably damaging	1.00
R8324:Sall2	UTSW	14	52312886	missense	probably benign	0.30
R9017:Sall2	UTSW	14	52313262	missense	possibly damaging	0.51
R9149:Sall2	UTSW	14	52313216	missense	possibly damaging	0.95
R9362:Sall2	UTSW	14	52313144	nonsense	probably null
R9571:Sall2	UTSW	14	52314373	missense	probably damaging	1.00
R9574:Sall2	UTSW	14	52314160	missense	probably damaging	1.00
R9641:Sall2	UTSW	14	52313425	missense	probably damaging	1.00
R9648:Sall2	UTSW	14	52313767	missense	probably damaging	1.00
R9694:Sall2	UTSW	14	52314667	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- CATGTTGCTGCAGAGTGACAG -3'
(R):5'- CCCTTATGTGCTAGAACCCTTG -3'

Sequencing Primer
(F):5'- CAGAGTGACAGCATTAGTGAACTTC -3'
(R):5'- GCCTTCTGAGACCTCAAAGCTG -3'

Posted On

2015-06-20